WormBase Tree Display for Variation: WBVar00088352
expand all nodes | collapse all nodes | view schema
WBVar00088352 | Evidence | Paper_evidence | WBPaper00026863 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ku258 | |||||||
Other_name | CE46860:p.Arg909His | ||||||||
R10E11.1b.1:c.2726G>A | |||||||||
CE47039:p.Arg898His | |||||||||
CE46909:p.Arg898His | |||||||||
R10E11.1a.2:c.2693G>A | |||||||||
R10E11.1a.1:c.2693G>A | |||||||||
R10E11.1c.1:c.2693G>A | |||||||||
HGVSg | CHROMOSOME_III:g.9770107G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R10E11 | |||||
Flanking_sequences | atattcccgattatcacgagatcatcaagc | cccaatggatttggaaaccgttcacaagaa | |||||||
Mapping_target | R10E11 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00026863 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026532 | ||||||||
WBStrain00047314 | |||||||||
Laboratory | MH | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000366 | |||||||
Transcript | R10E11.1c.1 (12) | ||||||||
R10E11.1b.1 (12) | |||||||||
R10E11.1a.2 (12) | |||||||||
R10E11.1a.1 (12) | |||||||||
Interactor (12) | |||||||||
Genetics | Interpolated_map_position | III | 0.995976 | ||||||
Description | Phenotype | WBPhenotype:0000007 | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 8% of fertile animals (n=53) were unable to lay eggs. The eggs eventually hatch within the animal. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000031 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Some animal exhibited slowed growth. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000032 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are generally sick and display a number of pleiotropic defects. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 4% progeny (n=428) fail to hatch. Embryos appear arrested shortly after gastrulation and hence exhibit differentiation in a number of tissues. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | 4% | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 10% animals die during larval development (n=411). Larval lethality occurred at various stages. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | 10% | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Sterility was observed in 19% of homozygous animals (n=65). | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Some animal exhibited slowed growth. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 8% animals (n=40) are aberrant in induction of VPCs; <3 of the VPCs, which are induced in wild type animals (P5.p to P7.p), are induced in these animals, as scored by Nomarski optics. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00049891 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | Quoted from text: "We found that cbp-1 (ku258 gf) mutants exhibited decreased fluorescence of the glr-1 transcriptional reporter (Fig 3G). Together, these results indicate that the CaMK signaling axis, including CKK-1/CaMKK, CMK-1/CaMK, CRH-1/CREB and CBP-1/CBP act to repress glr-1 transcription (Fig 3J)." | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Variation_effect | Gain_of_function_undetermined_type | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Strain | WBStrain00047314 | Paper_evidence | WBPaper00049891 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
Control_strain | WBStrain00047313 | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Genotype | pzIs29[Pglr-1::NLS-GFP::LacZ::unc-54 3'UTR] | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_not_observed | WBPhenotype:0000220 | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No ectopic VPC fusion events were observed as assayed by ajm-1::GFP expression patterns. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% animals display one or more ectopic pseudovulvae (n=233). | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001272 | Paper_evidence | WBPaper00026863 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | On average 2.94 VCPs (n=40 animals) are induced to adopt a vulval cell fate, which is near that of wild type, (3/6 VPCs induced n=29). VPCs and fate adoption were scored by Nomarski optics. | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Vulval induction was scored in late L3 to early L4 stage larvae, under Normarski optics. All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00026863 | ||||||||
WBPaper00049891 | |||||||||
Remark | The ku258 allele has two mutations. In addition to the R(909)H mutation described there is a E(1021)K mutation (based on the R10E11.1b isoform) | Curator_confirmed | WBPerson2970 | ||||||
Method | Substitution_allele |