WormBase Tree Display for Variation: WBVar00088443
expand all nodes | collapse all nodes | view schema
WBVar00088443 | Evidence | Paper_evidence | WBPaper00024676 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ky388 | ||||||
Other_name | F13B10.1d.1:c.-1668C>T | |||||||
F13B10.1a.2:c.85C>T | ||||||||
F13B10.1a.1:c.85C>T | ||||||||
CE50887:p.Arg29Ter | ||||||||
F13B10.1g.1:c.85C>T | ||||||||
CE20681:p.Arg29Ter | ||||||||
HGVSg | CHROMOSOME_III:g.3890926G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F13B10 | ||||
Flanking_sequences | tgcttcagaagtccccgcagtccacttgga | ggtgagttttttgctgaaaatttgggacat | ||||||
Mapping_target | F13B10 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024676 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00005265 | |||||||
Laboratory | CX | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006575 | ||||||
Transcript | F13B10.1a.1 | VEP_consequence | stop_gained,splice_region_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F13B10.1a.1:c.85C>T | |||||||
HGVSp | CE20681:p.Arg29Ter | |||||||
cDNA_position | 411 | |||||||
CDS_position | 85 | |||||||
Protein_position | 29 | |||||||
Exon_number | 4/14 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
F13B10.1g.1 | VEP_consequence | stop_gained,splice_region_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F13B10.1g.1:c.85C>T | |||||||
HGVSp | CE50887:p.Arg29Ter | |||||||
cDNA_position | 85 | |||||||
CDS_position | 85 | |||||||
Protein_position | 29 | |||||||
Exon_number | 1/10 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
F13B10.1d.1 | VEP_consequence | splice_region_variant,5_prime_UTR_variant | ||||||
VEP_impact | LOW | |||||||
HGVSc | F13B10.1d.1:c.-1668C>T | |||||||
cDNA_position | 394 | |||||||
Exon_number | 3/14 | |||||||
F13B10.1a.2 | VEP_consequence | stop_gained,splice_region_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F13B10.1a.2:c.85C>T | |||||||
HGVSp | CE20681:p.Arg29Ter | |||||||
cDNA_position | 197 | |||||||
CDS_position | 85 | |||||||
Protein_position | 29 | |||||||
Exon_number | 3/13 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Interactor | WBInteraction000501319 | |||||||
WBInteraction000518619 | ||||||||
WBInteraction000518620 | ||||||||
Genetics | Interpolated_map_position | III | -4.2437 | |||||
Mapping_data | In_pos_neg_data | 10953 | ||||||
10954 | ||||||||
10955 | ||||||||
Description | Phenotype | WBPhenotype:0001661 | Paper_evidence (2) | |||||
Curator_confirmed (2) | ||||||||
Remark | 2 AWC on | Paper_evidence | WBPaper00003760 | |||||
Curator_confirmed | WBPerson2021 | |||||||
The tir-1(ky388) temperature-sensitive mutant exhibits an incompletely penetrant 2AWC-ON phenotype (34% 2AWC-ON) at 15C. | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence (2) | ||||
Curator_confirmed (2) | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000006 | Paper_evidence | WBPaper00003760 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | superficially normal egg laying | Paper_evidence | WBPaper00003760 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | superficially normal movement | Paper_evidence | WBPaper00003760 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00039901 | |||||||
WBPaper00006052 | ||||||||
WBPaper00003760 | ||||||||
WBPaper00016621 | ||||||||
WBPaper00019278 | ||||||||
WBPaper00024131 | ||||||||
Method | Substitution_allele |