WormBase Tree Display for Variation: WBVar00088443
expand all nodes | collapse all nodes | view schema
WBVar00088443 | Evidence | Paper_evidence | WBPaper00024676 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ky388 | |||||||
Other_name | F13B10.1d.1:c.-1668C>T | ||||||||
F13B10.1a.2:c.85C>T | |||||||||
F13B10.1a.1:c.85C>T | |||||||||
CE50887:p.Arg29Ter | |||||||||
F13B10.1g.1:c.85C>T | |||||||||
CE20681:p.Arg29Ter | |||||||||
HGVSg | CHROMOSOME_III:g.3890926G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F13B10 | |||||
Flanking_sequences | tgcttcagaagtccccgcagtccacttgga | ggtgagttttttgctgaaaatttgggacat | |||||||
Mapping_target | F13B10 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024676 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005265 | ||||||||
Laboratory | CX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006575 | |||||||
Transcript | F13B10.1a.1 | VEP_consequence | stop_gained,splice_region_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F13B10.1a.1:c.85C>T | ||||||||
HGVSp | CE20681:p.Arg29Ter | ||||||||
cDNA_position | 411 | ||||||||
CDS_position | 85 | ||||||||
Protein_position | 29 | ||||||||
Exon_number | 4/14 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
F13B10.1g.1 | VEP_consequence | stop_gained,splice_region_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F13B10.1g.1:c.85C>T | ||||||||
HGVSp | CE50887:p.Arg29Ter | ||||||||
cDNA_position | 85 | ||||||||
CDS_position | 85 | ||||||||
Protein_position | 29 | ||||||||
Exon_number | 1/10 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
F13B10.1d.1 | VEP_consequence | splice_region_variant,5_prime_UTR_variant | |||||||
VEP_impact | LOW | ||||||||
HGVSc | F13B10.1d.1:c.-1668C>T | ||||||||
cDNA_position | 394 | ||||||||
Exon_number | 3/14 | ||||||||
F13B10.1a.2 | VEP_consequence | stop_gained,splice_region_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F13B10.1a.2:c.85C>T | ||||||||
HGVSp | CE20681:p.Arg29Ter | ||||||||
cDNA_position | 197 | ||||||||
CDS_position | 85 | ||||||||
Protein_position | 29 | ||||||||
Exon_number | 3/13 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor | WBInteraction000501319 | ||||||||
WBInteraction000518619 | |||||||||
WBInteraction000518620 | |||||||||
Genetics | Interpolated_map_position | III | -4.2437 | ||||||
Mapping_data | In_pos_neg_data | 10953 | |||||||
10954 | |||||||||
10955 | |||||||||
Description | Phenotype | WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||
WBPaper00039901 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | 2 AWC on | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
The tir-1(ky388) temperature-sensitive mutant exhibits an incompletely penetrant 2AWC-ON phenotype (34% 2AWC-ON) at 15C. | Paper_evidence | WBPaper00039901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive (2) | |||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003760 | ||||
WBPaper00039901 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000006 | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | superficially normal egg laying | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive (2) | |||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | superficially normal movement | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive (2) | |||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (6) | |||||||||
Method | Substitution_allele |