WormBase Tree Display for Variation: WBVar00088502
expand all nodes | collapse all nodes | view schema
WBVar00088502 | Evidence | Paper_evidence | WBPaper00031667 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | lj22 | ||||||
Other_name | CE52634:p.Arg54Cys | |||||||
T23F2.13.1:c.160C>T | ||||||||
HGVSg | CHROMOSOME_X:g.5493198C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T23F2 | ||||
Flanking_sequences | gtcccactttctctcgttatctggttcgtt | gtcgtgagctttgtaccgaaacttccgtcg | ||||||
Mapping_target | T23F2 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00031667 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000207 | |||||||
WBStrain00004743 | ||||||||
WBStrain00004744 | ||||||||
WBStrain00004764 | ||||||||
Laboratory | AQ | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00044623 | ||||||
WBGene00303081 | ||||||||
Transcript | T23F2.13.1 (12) | |||||||
Genetics | Interpolated_map_position | X | -5.24324 | |||||
Description | Phenotype | WBPhenotype:0000010 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals show enhanced sensitivity to drugs of a variety of sizes and structures. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Gravid hermaphrodites were placed into wells (of 96-well plates) containing the compound. Sensitivity was assessed based on the time until paralysis ensued. Concentrations of the compounds are as follows: Nicotine, 0.1%v/v in M9; 1-Phenoxypropan-2-ol , 0.1% or 0.5% in M9; Ivermectin dissolved in DMSO and diluted to 2.5ug/ml in M9. | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals show significant larval lethality. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 22.5 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001202 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Gravid hermaphrodites were placed into wells (of 96-well plates) containing the compound. Sensitivity was assessed based on the time until paralysis ensued. Concentrations of the compounds are as follows: Nicotine, 0.1%v/v in M9. | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001209 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are Unc. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001413 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000050 | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031667 | |||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00044623 UTR_5 | Paper_evidence | WBPaper00031667 | |||||
Method | Substitution_allele |