WormBase Tree Display for Variation: WBVar00088539
expand all nodes | collapse all nodes | view schema
WBVar00088539 | Evidence | Paper_evidence | WBPaper00002935 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | m27 | |||||||
Other_name (22) | |||||||||
HGVSg | CHROMOSOME_I:g.10773623G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R13H8 | |||||
Flanking_sequences | gatatctatgatgatctagaattcccatcat | ggttggcgaatcggttccagcaattccaagt | |||||||
Mapping_target | R13H8 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002935 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00006157 | ||||||||
WBStrain00006233 | |||||||||
Laboratory | DR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000912 | |||||||
Transcript (11) | |||||||||
Interactor (11) | |||||||||
Genetics | Interpolated_map_position | I | 5.111 | ||||||
Mapping_data | In_2_point | 442 | |||||||
In_multi_point | 336 | ||||||||
3631 | |||||||||
Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00000316 | |||||
WBPaper00000504 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000304 | Paper_evidence | WBPaper00004310 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals exhibit severely reduced responses to isoamyl alcohol (data not shown) | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00001063 | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000480 | Paper_evidence | WBPaper00004310 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals exhibit significantly reduced responses to pyrazine (data not shown) | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00005360 | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000731 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Weak increase in levels of apoptosis in daf-16 loss-of-function mutants treated with IR | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006796 | PATO:0000460 | Paper_evidence | WBPaper00029085 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Treated with 60 Gy IR | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001085 | Paper_evidence | WBPaper00004310 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals exhibit severely reduced responses to butanone (data not shown) | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00005086 | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001086 | Paper_evidence | WBPaper00004310 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals exhibit significantly reduced responses to trimethylthiazole (data not shown) | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00004538 | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00031942 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited a slightly shorter life span compared to wild-type animals. | Paper_evidence | WBPaper00031942 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown in microfuge tubes in 100l S medium (maintained) and incubated in thermocyclers. Worms were transferred into autoclaved, sterile microfuge tubes either every other day or once every 3 days, dependent upon the strain and stage of life of the worms used. Worms were monitored, counted and fed on a daily basis. Animals were shifted every 10 minutes between 12C and 25C. | Paper_evidence | WBPaper00031942 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 12, 12.5, 18.5, 25 | Paper_evidence | WBPaper00031942 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001775 | Paper_evidence | WBPaper00031942 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Unlike wild-type, growth under thermocycling conditions of 10 minute shifts between 12C and 25C, resulted in a shift in life span similar to the life span of animals reared at 18.5C continuously, not towards animals reared at 12C, as is the response of wild-type animals. | Paper_evidence | WBPaper00031942 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown in microfuge tubes in 100l S medium (maintained) and incubated in thermocyclers. Worms were transferred into autoclaved, sterile microfuge tubes either every other day or once every 3 days, dependent upon the strain and stage of life of the worms used. Worms were monitored, counted and fed on a daily basis. Animals were shifted every 10 minutes between 12C and 25C. | Paper_evidence | WBPaper00031942 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 12, 12.5, 18.5, 25 | Paper_evidence | WBPaper00031942 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000147 | Paper_evidence | WBPaper00040181 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | daf-16(m27) mutant worms responded to starvation as did wild-type N2 worms in both lpd-7 expression and rRNA synthesis. | Paper_evidence | WBPaper00040181 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00040181 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000481 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals did not display an abnormal aversion response to copper, compared to wild type animals (Figure 2B) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001470 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutants exhibited no change in chemotaxis towards diacetyl, compared to wild type controls (Figure 2A) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001789 | Paper_evidence | WBPaper00031942 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals displayed basically the same overall pattern as observed with wild-type animals in that animals were short lived at 25C, intermediate at 18.5C and long lived at 12.5C. | Paper_evidence | WBPaper00031942 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown in microfuge tubes in 100l S medium (maintained) and incubated in thermocyclers. Worms were transferred into autoclaved, sterile microfuge tubes either every other day or once every 3 days, dependent upon the strain and stage of life of the worms used. Worms were monitored, counted and fed on a daily basis. Animals were shifted every 10 minutes between 12C and 25C. | Paper_evidence | WBPaper00031942 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 12, 12.5, 18.5, 25 | Paper_evidence | WBPaper00031942 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001999 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The integration of signals for attraction to diacetyl (100x dilute) and avoidance from copper (100 millimolar) was normal (like wild type) in daf-16(m27) insulin-like signaling pathway mutants, resulting in the same number of animals crossing the copper barrier to get to the diacetyl spot compared to wild type controls (Figure 1C) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00002819 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals exhibit a wild type frequency of body bends (Figure 3A) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (13) | |||||||||
Method | Substitution_allele |