WormBase Tree Display for Variation: WBVar00088567
expand all nodes | collapse all nodes | view schema
WBVar00088567 | Evidence | Paper_evidence | WBPaper00003883 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | m77 | ||||||
Other_name | F01G10.8a.1:c.574C>T | |||||||
F01G10.8b.1:c.706C>T | ||||||||
CE29090:p.Gln192Ter | ||||||||
CE45907:p.Gln236Ter | ||||||||
HGVSg | CHROMOSOME_IV:g.10254765C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F01G10 | ||||
Flanking_sequences | aataagccactgaaatatgtgtttcggttg | aaaacaaaggagatcaaaaaagaatgaaaa | ||||||
Mapping_target | F01G10 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003883 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (12) | ||||||||
Laboratory | DR | |||||||
GOU | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000910 | ||||||
Transcript | F01G10.8b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F01G10.8b.1:c.706C>T | |||||||
HGVSp | CE45907:p.Gln236Ter | |||||||
cDNA_position | 725 | |||||||
CDS_position | 706 | |||||||
Protein_position | 236 | |||||||
Exon_number | 6/8 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
F01G10.8a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F01G10.8a.1:c.574C>T | |||||||
HGVSp | CE29090:p.Gln192Ter | |||||||
cDNA_position | 574 | |||||||
CDS_position | 574 | |||||||
Protein_position | 192 | |||||||
Exon_number | 4/6 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Interactor (58) | ||||||||
Genetics | Interpolated_map_position | IV | 4.56441 | |||||
Mapping_data | In_2_point | 436 | ||||||
437 | ||||||||
In_multi_point (12) | ||||||||
In_pos_neg_data | 957 | |||||||
965 | ||||||||
2738 | ||||||||
Description | Phenotype | WBPhenotype:0000012 | Paper_evidence | WBPaper00000502 | ||||
WBPaper00028386 | ||||||||
WBPaper00032073 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Recovered by selection for resistance to 1% SDS. | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | |||||||
Animals formed less than 10% dauer at 16C. | Paper_evidence | WBPaper00028386 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Constitutive dauer formation at 25C, incomplete penetrance, reversible by shift to 15C. Easy to score (ES3) at L3. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000502 | ||||
WBPaper00028386 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 16 | Paper_evidence | WBPaper00028386 | ||||
Curator_confirmed | WBPerson712 | |||||||
25 | Paper_evidence | WBPaper00032073 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-4(e120) | Paper_evidence | WBPaper00028386 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00038374 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We tested changes in the levels of these insulins using Q-PCR in TGFb pathway mutants such as daf-3(mgDf90), daf-14(m77) as well as pdp-1(tm3734) and compared them to wild-type worms (Figure 5A-5C, Figure S14, Tables S2 and S3). Interestingly, both pdp-1(tm3734) and daf-3(mgDf90) showed elevated levels of several insulins as compared to wild-type worms (Figure 5A and Figure S14). In contrast, expression of these insulins was markedly reduced in daf-14(m77) mutants (Figure 5B and Figure S14)." | Paper_evidence | WBPaper00038374 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000294 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dark intestine. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000545 | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Late-stage eggs are laid. | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Type C Egl; dark intestine. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000660 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | clumpy | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00032501 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants had enhanced susceptibility to killing by PA14 than N2 | Paper_evidence | WBPaper00032501 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001411 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Srf-6 at 16C. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001690 | Paper_evidence | WBPaper00002589 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals bind mAb M37 at stages L1-L4 but not as adults, wildtype worms only bind this anti-body at the L1 stage. Animals in dauer stage do not bind mAb 37, similar to wildtype. | Paper_evidence | WBPaper00002589 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | High | Pentrance ranged from 87-100%. | Paper_evidence | WBPaper00002589 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00002589 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 16 | Paper_evidence | WBPaper00002589 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00038374 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "In our hands, mutations in the upstream components of the TGF-b pathway such as daf-7 and daf-14 enhance dauer formation but do not significantly extend lifespan (Table S1 and Figure S4)." | Paper_evidence | WBPaper00038374 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00038374 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00001837 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Lifespans of adults were not noticeable different from wild type. Lifespans were examined when grown continuously at 15 deg C, or when shifted from 15 to 20 deg C and from 15 to 25 deg C as L4 animals. | Paper_evidence | WBPaper00001837 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001033 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No extension of the mitotic zone. | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001068 | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_assay | Treatment | 5 mg/ml serotonin | Paper_evidence | WBPaper00000635 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001215 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The number of PH3-positive cells in daf-14(m77) mutants was comparable to that in the wild-type germ line | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | anti-phospho-histone H3 antibody staining | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001340 | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_assay | Treatment | 0.75 mg/ml imipramine | Paper_evidence | WBPaper00000635 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference (20) | ||||||||
Method | Substitution_allele |