WormBase Tree Display for Variation: WBVar00088573
expand all nodes | collapse all nodes | view schema
WBVar00088573 | Name | Public_name | m85 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE06236:p.Arg416Ter | |||||||
R05D11.1.1:c.1246C>T | ||||||||
HGVSg | CHROMOSOME_I:g.8585160G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | R05D11 | ||||
Flanking_sequences | gaagttcgtggtctcattggaaagggtgtt | gattttacttgttagctggtgaagtctatg | ||||||
Mapping_target | R05D11 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00035610 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | DR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000904 | ||||||
Transcript | R05D11.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | R05D11.1.1:c.1246C>T | |||||||
HGVSp | CE06236:p.Arg416Ter | |||||||
cDNA_position | 1264 | |||||||
CDS_position | 1246 | |||||||
Protein_position | 416 | |||||||
Exon_number | 6/8 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Interactor | WBInteraction000052451 | |||||||
WBInteraction000052452 | ||||||||
WBInteraction000052472 | ||||||||
WBInteraction000502300 | ||||||||
WBInteraction000504246 | ||||||||
WBInteraction000536039 | ||||||||
WBInteraction000536040 | ||||||||
WBInteraction000536060 | ||||||||
WBInteraction000536063 | ||||||||
Genetics | Interpolated_map_position | I | 2.97481 | |||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutations in daf-8 confer an egg-laying defect | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000007 | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals died due to internal hatching of eggs. | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were raised at 15C and placed at 25.5C as L4 larvae or young adults for the life span assay. | Paper_evidence | WBPaper00002149 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 25.5C | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000012 | Paper_evidence | WBPaper00002149 | ||||||
WBPaper00028386 | ||||||||
WBPaper00035610 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2021 | ||||||||
Remark | Animals formed less than 10% dauer at 16C. | Paper_evidence | WBPaper00028386 | |||||
Curator_confirmed | WBPerson712 | |||||||
The temperature sensitive Daf-c phenotype is most penetrant at 25.5C | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
constitutive dauer formation at 25C, reversible by shift to 15C | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002149 | ||||
WBPaper00028386 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
25.5 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Temperature | 16 | Paper_evidence | WBPaper00028386 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-4(e120) | Paper_evidence | WBPaper00028386 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000135 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | lag-2 expression was upregulated in daf-8 loss-of-function mutants. daf-3 transcripts were not affected in daf-8 mutants | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | qRT-PCR | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutations in daf-8 confer reduced brood size | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000294 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | dark intestine | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | type C Egl at all temperatures | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001033 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The mitotic zone was significantly extended in daf-8(m85) | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001215 | Paper_evidence | WBPaper00035610 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | daf-8(m85) exhibited an increased number of PH3-positive cells | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035610 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | anti-phospho-histone H3 antibody staining | Paper_evidence | WBPaper00035610 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001687 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Srf-6 at 16C, easy to score (L3) at L3. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Cold_sensitive | 16 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Adult lifespan was not increased. Animals were allowed to progress through development at 15 degrees C. then shifted to 25.5 degrees C. to determine lifespan. | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were raised at 15C and placed at 25.5C as L4 larvae or young adults for the life span assay. | Paper_evidence | WBPaper00002149 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 25.5C | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00002149 | |||||||
WBPaper00014742 | ||||||||
WBPaper00028386 | ||||||||
WBPaper00015801 | ||||||||
WBPaper00035610 | ||||||||
Method | Substitution_allele |