WormBase Tree Display for Variation: WBVar00088613
expand all nodes | collapse all nodes | view schema
WBVar00088613 | Name | Public_name | m185 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C04C3.5c.1:c.373C>T | |||||||
CE38264:p.Arg136Ter | ||||||||
CE16811:p.Arg63Ter | ||||||||
C04C3.5a.1:c.187C>T | ||||||||
C04C3.5b.1:c.406C>T | ||||||||
C04C3.5a.2:c.187C>T | ||||||||
CE38265:p.Arg125Ter | ||||||||
HGVSg | CHROMOSOME_IV:g.3398371G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C04C3 | ||||
Flanking_sequences | aaactgtcgaaagttcagatgcaggaggtc | gaatcactcgtcagctatcatcacaactcc | ||||||
Mapping_target | C04C3 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024960 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034374 | |||||||
Laboratory | DR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001119 | ||||||
Transcript (4) | ||||||||
Interactor | WBInteraction000520974 | |||||||
Genetics | Interpolated_map_position | IV | -4.54036 | |||||
Mapping_data | In_multi_point | 3060 | ||||||
3063 | ||||||||
Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00002087 | ||||
Curator_confirmed | WBPerson48 | |||||||
Remark | 1-20% as many dauers formed as for N2. | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000646 | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Normal mobility when prodded. | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001434 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Chemotaxis defective. ME4(m185) | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001435 | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Chemotaxis frequency 0.12 versus 0.71 for N2. | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0002053 | Paper_evidence | WBPaper00055368 | ||||||
Curator_confirmed | WBPerson466 | |||||||
Remark | survive 10nM ivermectin | Paper_evidence | WBPaper00055368 | |||||
Curator_confirmed | WBPerson466 | |||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00055368 | ||||
Curator_confirmed | WBPerson466 | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00002087 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Remark | Defects in dye filling. | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
defective in dye (FITC or DiO) filling of amphid and phasmid neurons. Chemotaxis defective. ME4(m185) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_not_observed | WBPhenotype:0000398 | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000648 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ME4 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00029016 | |||||||
WBPaper00002087 | ||||||||
WBPaper00055368 | ||||||||
Method | Substitution_allele |