WormBase Tree Display for Variation: WBVar00088714
expand all nodes | collapse all nodes | view schema
WBVar00088714 | Evidence | Paper_evidence | WBPaper00005310 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | m596 | |||||||
Other_name | Y55D5A.5a.1:c.1639G>A | ||||||||
CE50312:p.Gly500Ser | |||||||||
Y55D5A.5c.1:c.1639G>A | |||||||||
Y55D5A.5e.1:c.1411G>A | |||||||||
Y55D5A.5d.1:c.1498G>A | |||||||||
CE46852:p.Gly547Ser | |||||||||
CE50204:p.Gly547Ser | |||||||||
CE50158:p.Gly471Ser | |||||||||
HGVSg | CHROMOSOME_III:g.3012922C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y55D5A | |||||
Flanking_sequences | gatatatttgcgaacattcacacgatcacc | gctacctgttggtacgtcaatcgtcaccgt | |||||||
Mapping_target | Y55D5A | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005310 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00006377 | ||||||||
WBStrain00040868 | |||||||||
WBStrain00040869 | |||||||||
WBStrain00040870 | |||||||||
WBStrain00040871 | |||||||||
Laboratory | DR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000898 | |||||||
Transcript | Y55D5A.5e.1 (12) | ||||||||
Y55D5A.5a.1 (12) | |||||||||
Y55D5A.5c.1 (12) | |||||||||
Y55D5A.5d.1 (12) | |||||||||
Interactor | WBInteraction000517967 | ||||||||
Genetics | Interpolated_map_position | III | -8.05974 | ||||||
Description | Phenotype | WBPhenotype:0000012 | Paper_evidence | WBPaper00035504 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Severe daf-c at 20C, 23C, and 25C. Strongest allele over e1370 and e1368. | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00032150 | |||||||
WBPaper00035504 | |||||||||
WBPaper00046170 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
WBPerson5092 | |||||||||
Remark | The mean lifespans at 20C +/- SE were: N2: 16.70.49; daf-2(m596): 27.61.0. | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Increased longevity compared to N2 | Paper_evidence | WBPaper00035504 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
compared to N2 at 15C. Longevity at 15C is skn-1 dependent. | Paper_evidence | WBPaper00046170 | |||||||
Curator_confirmed | WBPerson5092 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00032150 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000295 | Paper_evidence | WBPaper00035504 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | m596 showed moderate thermotolerance | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00035504 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The transcriptional profile of daf-2 mutants was altered compared to control | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000752 | Paper_evidence | WBPaper00037649 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The L2 stage was extended approximately twice the wild-type duration. | Paper_evidence | WBPaper00037649 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000964 | Paper_evidence | WBPaper00037649 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | strong resistance | Paper_evidence | WBPaper00037649 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00032150 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Worms had mildly increased levels of fat storage (TAGs) compared to N2. | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Synchronized L1s were plated on mixed isotope feeding plates composed of 12C- and 13C-enriched E. coli cultures, and collected after 44-48 hr of feeding (worms were harvested as mid-L4 larvae). All experiments were carried out at 20 deg C. | Paper_evidence | WBPaper00032150 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001742 | Paper_evidence | WBPaper00032150 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Worms had mildly increased levels of synthesized fatty acids compared to N2. | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Synchronized L1s were plated on mixed isotope feeding plates composed of 12C- and 13C-enriched E. coli cultures, and collected after 44-48 hr of feeding (worms were harvested as mid-L4 larvae). All experiments were carried out at 20 deg C. | Paper_evidence | WBPaper00032150 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001990 | Paper_evidence | WBPaper00035504 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | m596 showed moderate hypoxia resistance | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031936 | ||||||||
WBPaper00037649 | |||||||||
WBPaper00032150 | |||||||||
WBPaper00035504 | |||||||||
WBPaper00046170 | |||||||||
Method | Substitution_allele |