WormBase Tree Display for Variation: WBVar00088718
expand all nodes | collapse all nodes | view schema
| WBVar00088718 | Evidence | Paper_evidence | WBPaper00005086 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | m642 | |||||||
| Sequence_details | SMap | S_parent | Sequence | T13C5 | |||||
| Flanking_sequences | acctttcaatcatcctaacatgtggagata | tgtggacaggaggtatggaaactactgtaa | |||||||
| Mapping_target | T13C5 | ||||||||
| Type_of_mutation | Insertion | ||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Transposon_insertion | |||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | DR | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000905 | |||||||
| Transcript | T13C5.1c.1 | ||||||||
| T13C5.1b.1 | |||||||||
| T13C5.1a.1 | |||||||||
| Genetics | Interpolated_map_position | X | -3.46101 | ||||||
| Description | Phenotype | WBPhenotype:0000012 | Paper_evidence | WBPaper00005086 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000019 | Paper_evidence | WBPaper00005086 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Pumping is about half the rate of WT. | Paper_evidence | WBPaper00005086 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000061 | Paper_evidence | WBPaper00005086 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mean life span was extended at 15C. Maximum life span was increased modestly at 20C and 25 but substantially extended at 15C. | Paper_evidence | WBPaper00005086 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005086 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 15C, 20C, 25C | Paper_evidence | WBPaper00005086 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000077 | Paper_evidence | WBPaper00005086 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | 10% animals cannot shed their cuticle post molting from Dauer, which can result in death. Shed cuticle remains attached to the worm resulting in a constriction in the body. | Paper_evidence | WBPaper00005086 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | Low | Paper_evidence | WBPaper00005086 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000301 | Paper_evidence | WBPaper00005086 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000308 | Paper_evidence | WBPaper00005086 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | 30-40% animals exit Dauer. | Paper_evidence | WBPaper00005086 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000688 | Paper_evidence | WBPaper00005086 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals that exit dauer molt and grow to sterile adults after several days. | Paper_evidence | WBPaper00005086 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000699 | Paper_evidence | WBPaper00005086 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals are either vulvaless or present abnormal pseuodvulval protrusions. | Paper_evidence | WBPaper00005086 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00005086 | ||||||||
| Method | Transposon_insertion |
