WormBase Tree Display for Variation: WBVar00088948
expand all nodes | collapse all nodes | view schema
WBVar00088948 | Evidence | Paper_evidence | WBPaper00032966 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mg360 | |||||||
Other_name | F29C12.3b.1:c.3206G>A | ||||||||
F29C12.3a.1:c.3200G>A | |||||||||
F29C12.3c.1:c.770G>A | |||||||||
CE45435:p.Gly1069Glu | |||||||||
CE43301:p.Gly1067Glu | |||||||||
CE45505:p.Gly257Glu | |||||||||
HGVSg | CHROMOSOME_II:g.13104077C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F29C12 | |||||
Flanking_sequences | aggcgagcctgctggcagtatcaagtatcg | aagcacagatggtggatttgagatccttccc | |||||||
Mapping_target | F29C12 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00032966 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00023647 | ||||||||
Laboratory | GR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00009245 | |||||||
Transcript | F29C12.3b.1 (12) | ||||||||
F29C12.3c.1 (12) | |||||||||
F29C12.3a.1 (12) | |||||||||
Interactor | WBInteraction000524975 | ||||||||
WBInteraction000524976 | |||||||||
WBInteraction000524977 | |||||||||
WBInteraction000524978 | |||||||||
WBInteraction000524979 | |||||||||
WBInteraction000524980 | |||||||||
WBInteraction000524981 | |||||||||
WBInteraction000524982 | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | II | 14.2761 | ||||||
Description | Phenotype | WBPhenotype:0000128 | Paper_evidence | WBPaper00053668 | |||||
Curator_confirmed | WBPerson31364 | ||||||||
Remark | animals show increased rates of dauer formation at 27°C but not 25°C in the absence of pheromone. | Paper_evidence | WBPaper00053668 | ||||||
Curator_confirmed | WBPerson31364 | ||||||||
WBPhenotype:0000130 | Paper_evidence | WBPaper00053668 | |||||||
Curator_confirmed | WBPerson31364 | ||||||||
Remark | animals display increased rates of dauer formation in the presence of ascr#5 pheromone | Paper_evidence | WBPaper00053668 | ||||||
Curator_confirmed | WBPerson31364 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | lpo-6 animals produced 40% fewer progeny than wild-type | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000164 | Paper_evidence | WBPaper00032966 | |||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Thin | Paper_evidence | WBPaper00032966 | ||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00032966 | ||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00032966 | |||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032966 | ||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00032966 | |||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Small | Paper_evidence | WBPaper00032966 | ||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
lpo-6 mutants displayed decreased adult body size | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00032966 | ||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00032966 | |||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032966 | |||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00032966 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000848 | Paper_evidence | WBPaper00032966 | |||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Developmental delay | Paper_evidence | WBPaper00032966 | ||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
lpo-6 mutants displayed slight developmental delay | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00032966 | ||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00032966 | |||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032966 | |||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00032966 | |||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Increased fat | Paper_evidence | WBPaper00032966 | ||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
The excess fat accumulation of lpo-6 (mg360) mutants was associated with enlarged lipid-storing subcellular particles throughout intestinal cells, as well as an overall increase in Nile Red fluorescence and by staining with other lipid dyesfatty acid conjugated BODIPY and the fixed stain Sudan Black | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00032966 | ||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00032966 | |||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032966 | |||||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Altered Nile Red staining | Paper_evidence | WBPaper00032966 | |||||
Person_evidence | WBPerson6788 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Nile Red staining, BODIPY staining and the fixed stain Sudan Black | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00053668 | |||||||
Curator_confirmed | WBPerson31364 | ||||||||
Remark | animals display reduced ASI expression of daf-7p::GFP (ksIs2) at 27°C | Paper_evidence | WBPaper00053668 | ||||||
Curator_confirmed | WBPerson31364 | ||||||||
WBPhenotype:0001462 | Paper_evidence | WBPaper00051289 | |||||||
Curator_confirmed | WBPerson10274 | ||||||||
Remark | Figure 3B | Paper_evidence | WBPaper00051289 | ||||||
Curator_confirmed | WBPerson10274 | ||||||||
Phenotype_not_observed | WBPhenotype:0001006 | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The pumping rate of lpo-6 (mg360) animals was indistinguishable from that of wild-type animals under well-fed conditions | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00032966 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032966 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00032966 | ||||||||
WBPaper00051289 | |||||||||
WBPaper00053668 | |||||||||
Method | Substitution_allele |