WormBase Tree Display for Variation: WBVar00089036
expand all nodes | collapse all nodes | view schema
WBVar00089036 | Evidence | Paper_evidence | WBPaper00003929 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mn112 | |||||||
Sequence_details | SMap | S_parent | Sequence | C05G5 | |||||
Flanking_sequences | ctagatgagtagcccacctagcagcggtcg | gaggtagtaggttgtatagtttggaatatt | |||||||
Mapping_target | C05G5 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007936 | ||||||||
WBStrain00029078 | |||||||||
WBStrain00030773 | |||||||||
WBStrain00030774 | |||||||||
WBStrain00034162 | |||||||||
Laboratory | SP | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002285 | |||||||
Transcript | C05G5.6 | ||||||||
Interactor (15) | |||||||||
Genetics | Interpolated_map_position | X | 21.2157 | ||||||
Mapping_data | In_2_point | 192 | |||||||
In_multi_point | 188 | ||||||||
In_pos_neg_data | 2068 | ||||||||
2096 | |||||||||
2200 | |||||||||
2205 | |||||||||
2212 | |||||||||
2218 | |||||||||
2224 | |||||||||
2275 | |||||||||
2279 | |||||||||
Description | Phenotype | WBPhenotype:0000033 | Paper_evidence | WBPaper00003929 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000058 | Paper_evidence | WBPaper00000241 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Hermaphrodite die at the third larval stage; hemizygous males can survive until late L4. | Paper_evidence | WBPaper00000241 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
late larval lethal | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000060 | Paper_evidence | WBPaper00003929 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The lethal phenotype is nearly identical to n2853 although it is not temperature sensitive. | Paper_evidence | WBPaper00003929 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001422 | Paper_evidence | WBPaper00003929 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00003929 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00031590 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals produced no live progeny from 10 adult worms. | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | unc-3(e151) | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000065 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO die at late L4 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000066 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XX animals die at early L3 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00031590 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals produced 2-5% fertile eggs (n>100). | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | unc-3(e151) | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001365 | Paper_evidence | WBPaper00000241 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Reference | WBPaper00015364 | ||||||||
WBPaper00022656 | |||||||||
WBPaper00003929 | |||||||||
WBPaper00000241 | |||||||||
WBPaper00011121 | |||||||||
WBPaper00031590 | |||||||||
Method | Deletion_allele |