WormBase Tree Display for Variation: WBVar00089190

WBVar00089190 Evidence: Paper_evidence: WBPaper00004727
  Name: Public_name: ms23
    HGVSg: CHROMOSOME_III:g.7839293_7841156del
  Sequence_details: SMap: S_parent: Sequence: ZK652
    Flanking_sequences: ctactaatgagtggtaaattttgagctttg agtcggagcagaacgagaaaatcttgctca
    Mapping_target: ZK652
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00029284
    Laboratory: YK
    Status: Live
  Affects: Gene: WBGene00000446
    Transcript: ZK652.5.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-709
        CDS_position: ?-707
        Protein_position: ?-236
        Intron_number: 2-4/5
        Exon_number: 1-5/6
    Interactor: WBInteraction000003409
  Genetics: Interpolated_map_position: III -0.564307
    Mapping_data: In_multi_point: 4206
  Description: Phenotype_not_observed: WBPhenotype:0000520 Paper_evidence: WBPaper00004727
        Curator_confirmed: WBPerson557
      WBPhenotype:0000643 Paper_evidence: WBPaper00004727
        Curator_confirmed: WBPerson557
      WBPhenotype:0000905 Paper_evidence: WBPaper00004727
        Curator_confirmed: WBPerson557
        Remark: For the ceh-23(ms23) mutant allele the authors found that the AFD and ASE cell fate markers gcy-8::gfp and gcy-5::gfp, respectively, the ADF, ADL, PHA, PHB cell fate marker srb-6::gfp, the AWC cell fate marker str-2::gfp and the CAN cell fate marker kal-1::gfp were all correctly expressed. In the ceh-23(ms23) mutant, ADL and PHA/PHB show normal dye filling behavior. In those cases where the neuron could be visualized in relative isolation (AFD, ASE, AWC, CAN, PHA/B), the anatomy of the neuron appeared wild type. Paper_evidence: WBPaper00004727
            Curator_confirmed: WBPerson557
      WBPhenotype:0001765 Paper_evidence: WBPaper00031936
        Curator_confirmed: WBPerson2021
        Remark: Mutants respond normally to CO2 Paper_evidence: WBPaper00031936
            Curator_confirmed: WBPerson2021
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00031936
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: 10% CO2 Paper_evidence: WBPaper00031936
              Curator_confirmed: WBPerson2021
      WBPhenotype:0002513 Paper_evidence: WBPaper00004727
        Curator_confirmed: WBPerson557
      WBPhenotype:0002535 Paper_evidence: WBPaper00004727
        Curator_confirmed: WBPerson557
        Remark: In the ceh-23(ms23) mutant, ADL and PHA/PHB show normal dye filling behavior. In those cases where the neuron could be visualized in relative isolation (AFD, ASE, AWC, CAN, PHA/B), the anatomy of the neuron appeared wild type. Paper_evidence: WBPaper00004727
            Curator_confirmed: WBPerson557
  Reference: WBPaper00031936
    WBPaper00004727
  Remark: ms23 is a mutation of 1864 bp deletion starting from 301 bp 5' of the ATG start codon into the last exon of the gene and deletes more than 75% of the coding sequence, including half of the homeobox [030414 ck1]
  Method: Deletion_allele