WormBase Tree Display for Variation: WBVar00089202
expand all nodes | collapse all nodes | view schema
| WBVar00089202 | Name | Public_name | mu31 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | F43C9.4a.1:c.398-1G>A | ||||||||
| F43C9.4b.1:c.380-1G>A | |||||||||
| F43C9.4a.2:c.398-1G>A | |||||||||
| HGVSg | CHROMOSOME_X:g.4798636C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F43C9 | |||||
| Flanking_sequences | tgatcaagtggatgtacttgggtaattgca | gacaattttgtggacactttgaaaatcgca | |||||||
| Mapping_target | F43C9 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003594 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004833 | ||||||||
| Laboratory | CF | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003245 | |||||||
| Transcript | F43C9.4b.1 | VEP_consequence | splice_acceptor_variant | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F43C9.4b.1:c.380-1G>A | ||||||||
| Intron_number | 2/6 | ||||||||
| F43C9.4a.2 | VEP_consequence | splice_acceptor_variant | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F43C9.4a.2:c.398-1G>A | ||||||||
| Intron_number | 5/10 | ||||||||
| F43C9.4a.1 | VEP_consequence | splice_acceptor_variant | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F43C9.4a.1:c.398-1G>A | ||||||||
| Intron_number | 4/9 | ||||||||
| Genetics | Interpolated_map_position | X | -6.23646 | ||||||
| Mapping_data | In_multi_point | 2087 | |||||||
| 2088 | |||||||||
| Description | Phenotype | WBPhenotype:0000469 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Defects in migration of cells descended from QR. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001118 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Positions of a few other cells (BDU, ALM, left coelomocytes) sometimes abnormal. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006826 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBbt:0005406 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBbt:0005751 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000470 | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | HSN wildtype. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00003594 | ||||||||
| WBPaper00017207 | |||||||||
| Method | Substitution_allele |
