WormBase Tree Display for Variation: WBVar00089237
expand all nodes | collapse all nodes | view schema
WBVar00089237 | Evidence | Paper_evidence | WBPaper00004710 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mu220 | |||||||
Other_name | T01E8.2.1:c.71G>A | ||||||||
CE02306:p.Arg24Gln | |||||||||
HGVSg | CHROMOSOME_II:g.10218543G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T01E8 | |||||
Flanking_sequences | acagaaaaacatcacaggagaagaaacgac | agatgagattaatgcaaagatcaaggagct | |||||||
Mapping_target | T01E8 | ||||||||
Type_of_mutation | Substitution | G | A | Paper_evidence | WBPaper00004710 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004843 | ||||||||
Laboratory | CF | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004334 | |||||||
Transcript | T01E8.2.1 (12) | ||||||||
Interactor (12) | |||||||||
Genetics | Interpolated_map_position | II | 2.25321 | ||||||
Mapping_data | In_multi_point | 4630 | |||||||
Description | Phenotype | WBPhenotype:0000071 | Paper_evidence | WBPaper00004710 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ref-1(mu220) larvae occasionally have misshapen heads. These head defects vary considerably, ranging from small notches or lumps in the side of the worm head to strongly bent heads. | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000166 | Paper_evidence | WBPaper00004710 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ref-1 mutant animals stained with the MH27 antiserum show the H1 seam cell occasionally fused inappropriately with either hyp7 or another head syncytial cell. Posterior seam cells did not display any defects in newly hatched ref-1(mu220) mutants, a defect was present later in development in the posteriorly located V6 cell. | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00004710 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000239 | Paper_evidence | WBPaper00004710 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Anterior Pn.p cells (P1.p and P2.p) and other lateral hypodermal cell fusions in the worm were largely unaffected, suggesting that this mutation affects the pattern of Pn.p cell fusion and not cell fusion more generally. ref-1 also did not affect the male Pn.p cell fusion pattern (datanot shown). ref-1 specifically affects Pn.p cell fusionearly but not later during larval development. | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004710 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00004710 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | At low frequency in ref-1(mu220) worms, V6 generates a postdeirid-like structure indicating a partial transformation of V6 to V5. | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004875 | PATO:0000460 | Paper_evidence | WBPaper00004710 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004890 | PATO:0000460 | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00004710 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ref-1(mu220) frequently had between one and three ectopic pseudovulvae in the posterior body region. | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004710 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000938 | Paper_evidence | WBPaper00004710 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ref-1 mutants occasionally lack two V-cell-derived rays. | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00004710 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001194 | Paper_evidence | WBPaper00004710 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The ectopic postdeirid phenotype was only about 10% penetrant in a strain that was outcrossed three times. | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | 10% | Paper_evidence | WBPaper00004710 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004710 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00004710 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004875 | PATO:0000460 | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004874 | PATO:0000460 | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00004710 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Small gaps were sometimes seen in the alae in the V6 body region in ref-1 mutants. | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007832 | PATO:0000460 | Paper_evidence | WBPaper00004710 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000717 | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Little or no detectable difference was observed in lin-39 expression between wild-type and ref-1(mu220) animals. | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004710 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004710 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00027236 | ||||||||
WBPaper00004710 | |||||||||
WBPaper00017746 | |||||||||
Method | Substitution_allele |