WormBase Tree Display for Variation: WBVar00089424
expand all nodes | collapse all nodes | view schema
WBVar00089424 | Evidence | Paper_evidence | WBPaper00031068 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n324 | ||||||
Other_name (2) | ||||||||
HGVSg | CHROMOSOME_I:g.5685157A>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T19B4 | ||||
Flanking_sequences | cgagaaccagaagacgtcgaacggaggcct | acggtgcagacgaagtcattggaactcctg | ||||||
Mapping_target | T19B4 | |||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (4) | ||||||||
Affects | Gene | WBGene00006776 | ||||||
Transcript | T19B4.7.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | T19B4.7.1:c.1331T>A | |||||||
HGVSp | CE25115:p.Leu444Ter | |||||||
cDNA_position | 1394 | |||||||
CDS_position | 1331 | |||||||
Protein_position | 444 | |||||||
Exon_number | 10/19 | |||||||
Codon_change | tTa/tAa | |||||||
Amino_acid_change | L/* | |||||||
Interactor | WBInteraction000500889 | |||||||
WBInteraction000518897 | ||||||||
WBInteraction000518900 | ||||||||
WBInteraction000536176 | ||||||||
WBInteraction000536177 | ||||||||
WBInteraction000536178 | ||||||||
WBInteraction000536179 | ||||||||
WBInteraction000536180 | ||||||||
Genetics | Interpolated_map_position | I | 0.309528 | |||||
Description | Phenotype (26) | |||||||
Phenotype_not_observed | WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001931 | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The number of lateral muscle arms did not differ significantly from control animals. | Paper_evidence | WBPaper00032907 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038152 | |||||||
WBPaper00040147 | ||||||||
WBPaper00043908 | ||||||||
WBPaper00035198 | ||||||||
WBPaper00001105 | ||||||||
WBPaper00032907 | ||||||||
WBPaper00036485 | ||||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | ||||||
Method | Substitution_allele |