WormBase Tree Display for Variation: WBVar00089445
expand all nodes | collapse all nodes | view schema
| WBVar00089445 | Evidence | Paper_evidence | WBPaper00001467 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n355 | |||||
| Other_name | n355sd | ||||||
| Sequence_details | SMap | S_parent | Sequence | T25C12 | |||
| Flanking_sequences | cactcacgctcattccaaattatccccatc | tgaccccggactgttttatccaaacctata | |||||
| Mapping_target | T25C12 | ||||||
| Type_of_mutation | Insertion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00026724 | ||||||
| WBStrain00026766 | |||||||
| WBStrain00026800 | |||||||
| WBStrain00026839 | |||||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Linked_to | WBVar00089446 | ||||||
| WBVar00089447 | |||||||
| WBVar00089448 | |||||||
| WBVar00089449 | |||||||
| Affects | Gene | WBGene00220093 | |||||
| WBGene00003003 | |||||||
| Transcript | T25C12.1b.1 | ||||||
| T25C12.11 | |||||||
| T25C12.1a.1 | |||||||
| Interactor | WBInteraction000520755 | ||||||
| Genetics | Interpolated_map_position | X | 3.87494 | ||||
| Description | Phenotype | WBPhenotype:0000113 | Paper_evidence | WBPaper00056201 | |||
| Curator_confirmed | WBPerson44293 | ||||||
| Remark | Figure 2a, n355 mutants have elevated SL1-LCE expression at later larval stages | Paper_evidence | WBPaper00056201 | ||||
| Curator_confirmed | WBPerson44293 | ||||||
| WBPhenotype:0000114 | Paper_evidence | WBPaper00026761 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Northern and qRT-PCR analyses of RNA collected from lin-14(n355gf) worms indicated that mRNA expression from this mutant allele was not subject to the same level of downregulation observed in wild-type worms from the L1 to L2 stages. | Paper_evidence | WBPaper00026761 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00026761 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000438 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Class I, retarded heterochronic alterations in many lineages | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Hypermorph_gain_of_function | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00041184 | ||||||
| WBPaper00016053 | |||||||
| WBPaper00020777 | |||||||
| WBPaper00026761 | |||||||
| WBPaper00016093 | |||||||
| WBPaper00016468 | |||||||
| WBPaper00014201 | |||||||
| WBPaper00056201 | |||||||
| WBPaper00065849 | |||||||
| Remark | n355 is an insertion or inversion of at least 10kb of unknown DNA sequence. | Paper_evidence | WBPaper00001467 | ||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003003 UTR_3 | Paper_evidence | WBPaper00001467 | |||||
| Method | Insertion_allele |
