WormBase Tree Display for Variation: WBVar00089458
expand all nodes | collapse all nodes | view schema
| WBVar00089458 | Evidence | Paper_evidence | WBPaper00003628 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n369 | |||||||
| Other_name | F54B11.3a.1:c.263_264delinsAA | ||||||||
| F54B11.3b.1:c.263_264delinsAA | |||||||||
| CE28236:p.Trp88Ter | |||||||||
| CE27761:p.Trp88Ter | |||||||||
| HGVSg | CHROMOSOME_X:g.13585536_13585537delinsAA | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F54B11 | |||||
| Flanking_sequences | aaatctacgatccatccttgccggaccact | gaagtgccaaaccttggtggtactacttca | |||||||
| Mapping_target | F54B11 | ||||||||
| Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00003628 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006816 | |||||||
| Transcript | F54B11.3a.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F54B11.3a.1:c.263_264delinsAA | ||||||||
| HGVSp | CE28236:p.Trp88Ter | ||||||||
| cDNA_position | 268-269 | ||||||||
| CDS_position | 263-264 | ||||||||
| Protein_position | 88 | ||||||||
| Exon_number | 3/12 | ||||||||
| Codon_change | tGG/tAA | ||||||||
| Amino_acid_change | W/* | ||||||||
| F54B11.3b.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F54B11.3b.1:c.263_264delinsAA | ||||||||
| HGVSp | CE27761:p.Trp88Ter | ||||||||
| cDNA_position | 268-269 | ||||||||
| CDS_position | 263-264 | ||||||||
| Protein_position | 88 | ||||||||
| Exon_number | 3/9 | ||||||||
| Codon_change | tGG/tAA | ||||||||
| Amino_acid_change | W/* | ||||||||
| Interactor | WBInteraction000557550 | ||||||||
| WBInteraction000557551 | |||||||||
| Genetics | Interpolated_map_position | X | 13.7255 | ||||||
| Description | Phenotype | WBPhenotype:0000511 | Paper_evidence | WBPaper00038236 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | In unc-84(n369) null animals, nuclear migration is disrupted, and 14-15 hyp7 nuclei mislocalize to the dorsal cord of L1 larvae. | Paper_evidence | WBPaper00038236 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00006526 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Matefin localization was normal in unc-84(n369) null embryos and gonads | Paper_evidence | WBPaper00006526 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00006526 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00006526 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00006526 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Indirect immunofluorescence for endogenous Ce-lamin and endogenous matefin | Paper_evidence | WBPaper00006526 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00038236 | ||||||||
| WBPaper00003628 | |||||||||
| WBPaper00024053 | |||||||||
| WBPaper00006526 | |||||||||
| WBPaper00016044 | |||||||||
| Method | Substitution_allele |
