WormBase Tree Display for Variation: WBVar00089461
expand all nodes | collapse all nodes | view schema
WBVar00089461 | Evidence | Person_evidence | WBPerson23830 | ||
---|---|---|---|---|---|
Name | Public_name | n372 | |||
Other_name | CE26703:p.Glu30Lys | ||||
Y54G2A.1.1:c.88G>A | |||||
HGVSg | CHROMOSOME_IV:g.3019924G>A | ||||
Sequence_details | SMap | S_parent | Sequence | Y54G2A | |
Flanking_sequences | caacattttcagaaaaacaaacctctaatg | agaagaaacggagagctcgaataaacaagt | |||
Mapping_target | Y54G2A | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain (5) | |||||
Laboratory | MT | ||||
Status | Live | ||||
Affects | Gene | WBGene00003008 | |||
Transcript | Y54G2A.1.1 (12) | ||||
Genetics | Interpolated_map_position | IV | -6.65615 | ||
Mapping_data | In_multi_point | 683 | |||
684 | |||||
691 | |||||
Description (2) | |||||
Reference | WBPaper00006052 | ||||
WBPaper00022140 | |||||
WBPaper00013704 | |||||
WBPaper00001576 | |||||
WBPaper00014771 | |||||
WBPaper00016173 | |||||
WBPaper00016309 | |||||
WBPaper00013803 | |||||
WBPaper00016477 | |||||
WBPaper00056582 | |||||
Remark | alt_det = g to a mut_det = E(30)K | Person_evidence | WBPerson23830 | ||
Curator_confirmed | WBPerson51134 | ||||
Sequence data from The role of lin-22, a hairy/Enhancer of split homolog, in patterning the peripheral nervous system of C. elegans, Lisa A. Wrischnik and Cynthia J. Kenyon, Development, 1997 | Person_evidence | WBPerson23830 | |||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by WBPerson23830 on 2021-05-7_10:00:52 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
Method | Substitution_allele |