WormBase Tree Display for Variation: WBVar00089461
expand all nodes | collapse all nodes | view schema
WBVar00089461 | Evidence | Person_evidence | WBPerson23830 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n372 | ||||||
Other_name | CE26703:p.Glu30Lys | |||||||
Y54G2A.1.1:c.88G>A | ||||||||
HGVSg | CHROMOSOME_IV:g.3019924G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | Y54G2A | ||||
Flanking_sequences | caacattttcagaaaaacaaacctctaatg | agaagaaacggagagctcgaataaacaagt | ||||||
Mapping_target | Y54G2A | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004555 | |||||||
WBStrain00004801 | ||||||||
WBStrain00004805 | ||||||||
WBStrain00004806 | ||||||||
WBStrain00026726 | ||||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003008 | ||||||
Transcript | Y54G2A.1.1 (12) | |||||||
Genetics | Interpolated_map_position | IV | -6.65615 | |||||
Mapping_data | In_multi_point (3) | |||||||
Description | Phenotype (2) | |||||||
Phenotype_not_observed | WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00006052 | |||||||
WBPaper00022140 | ||||||||
WBPaper00013704 | ||||||||
WBPaper00001576 | ||||||||
WBPaper00014771 | ||||||||
WBPaper00016173 | ||||||||
WBPaper00016309 | ||||||||
WBPaper00013803 | ||||||||
WBPaper00016477 | ||||||||
WBPaper00056582 | ||||||||
Remark | alt_det = g to a mut_det = E(30)K | Person_evidence | WBPerson23830 | |||||
Curator_confirmed | WBPerson51134 | |||||||
Sequence data from The role of lin-22, a hairy/Enhancer of split homolog, in patterning the peripheral nervous system of C. elegans, Lisa A. Wrischnik and Cynthia J. Kenyon, Development, 1997 | Person_evidence | WBPerson23830 | ||||||
Curator_confirmed | WBPerson51134 | |||||||
Variation information submitted by WBPerson23830 on 2021-05-7_10:00:52 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||||||
Method | Substitution_allele |