WormBase Tree Display for Variation: WBVar00089461
expand all nodes | collapse all nodes | view schema
WBVar00089461 | Evidence | Person_evidence | WBPerson23830 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n372 | |||||||
Other_name | CE26703:p.Glu30Lys | ||||||||
Y54G2A.1.1:c.88G>A | |||||||||
HGVSg | CHROMOSOME_IV:g.3019924G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y54G2A | |||||
Flanking_sequences | caacattttcagaaaaacaaacctctaatg | agaagaaacggagagctcgaataaacaagt | |||||||
Mapping_target | Y54G2A | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00003008 | |||||||
Transcript | Y54G2A.1.1 (12) | ||||||||
Genetics | Interpolated_map_position | IV | -6.65615 | ||||||
Mapping_data | In_multi_point | 683 | |||||||
684 | |||||||||
691 | |||||||||
Description | Phenotype | WBPhenotype:0001411 | Paper_evidence | WBPaper00001576 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males show ectopic WGA surface binding. 20% self-fertile XX animals transformed with her-1 show WGA surface binding characteristic of lin-22(n372) males. | Paper_evidence | WBPaper00001576 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001576 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | See materials and methods for detailed lectin binding treatment. | Paper_evidence | WBPaper00001576 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | her-1(y101) | Paper_evidence | WBPaper00001576 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002496 | Paper_evidence | WBPaper00056582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | While wild-type animals only display a single dat-1::gfp(+) neuron pair in the midbody region, the PDE neuron pair from the postdeirid lineage, all 4 mutant alleles display ectopic dat1::gfp expression along the anterior/posterior axis of the animal | Paper_evidence | WBPaper00056582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00056582 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00006052 | ||||||||
WBPaper00022140 | |||||||||
WBPaper00013704 | |||||||||
WBPaper00001576 | |||||||||
WBPaper00014771 | |||||||||
WBPaper00016173 | |||||||||
WBPaper00016309 | |||||||||
WBPaper00013803 | |||||||||
WBPaper00016477 | |||||||||
WBPaper00056582 | |||||||||
Remark | alt_det = g to a mut_det = E(30)K | Person_evidence | WBPerson23830 | ||||||
Curator_confirmed | WBPerson51134 | ||||||||
Sequence data from The role of lin-22, a hairy/Enhancer of split homolog, in patterning the peripheral nervous system of C. elegans, Lisa A. Wrischnik and Cynthia J. Kenyon, Development, 1997 | Person_evidence | WBPerson23830 | |||||||
Curator_confirmed | WBPerson51134 | ||||||||
Variation information submitted by WBPerson23830 on 2021-05-7_10:00:52 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||||
Method | Substitution_allele |