WormBase Tree Display for Variation: WBVar00089522
expand all nodes | collapse all nodes | view schema
| WBVar00089522 | Evidence | Paper_evidence | WBPaper00005609 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n475 | |||||||
| Other_name | CE28339:p.Lys34Ter | ||||||||
| F55A8.1b.1:c.100A>T | |||||||||
| CE48960:p.Lys34Ter | |||||||||
| F55A8.1a.2:c.100A>T | |||||||||
| F55A8.1a.1:c.100A>T | |||||||||
| HGVSg | CHROMOSOME_IV:g.1913571A>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F55A8 | |||||
| Flanking_sequences | aggccgtcagatgagccgtgtagtggttgc | aacagttacagaaggatgttgcaaaggtaa | |||||||
| Mapping_target | F55A8 | ||||||||
| Type_of_mutation | Substitution | a | t | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00026869 | ||||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00305452 | |||||||
| WBGene00001186 | |||||||||
| Transcript | F55A8.1b.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F55A8.1b.1:c.100A>T | ||||||||
| HGVSp | CE48960:p.Lys34Ter | ||||||||
| cDNA_position | 126 | ||||||||
| CDS_position | 100 | ||||||||
| Protein_position | 34 | ||||||||
| Exon_number | 2/6 | ||||||||
| Codon_change | Aaa/Taa | ||||||||
| Amino_acid_change | K/* | ||||||||
| F55A8.7 | |||||||||
| F55A8.1a.2 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F55A8.1a.2:c.100A>T | ||||||||
| HGVSp | CE28339:p.Lys34Ter | ||||||||
| cDNA_position | 158 | ||||||||
| CDS_position | 100 | ||||||||
| Protein_position | 34 | ||||||||
| Exon_number | 3/7 | ||||||||
| Codon_change | Aaa/Taa | ||||||||
| Amino_acid_change | K/* | ||||||||
| F55A8.1a.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F55A8.1a.1:c.100A>T | ||||||||
| HGVSp | CE28339:p.Lys34Ter | ||||||||
| cDNA_position | 118 | ||||||||
| CDS_position | 100 | ||||||||
| Protein_position | 34 | ||||||||
| Exon_number | 2/6 | ||||||||
| Codon_change | Aaa/Taa | ||||||||
| Amino_acid_change | K/* | ||||||||
| Interactor | WBInteraction000501041 | ||||||||
| Genetics | Interpolated_map_position | IV | -13.212 | ||||||
| Description | Phenotype (13) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000414 | Paper_evidence | WBPaper00004408 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Animals do not exhibit two large P11.p-like hypodermal nuclei immediately anterior to the anus, indicating a P12 to P11 cell-fate transformation (Table 3) | Paper_evidence | WBPaper00004408 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006899 | PATO:0000460 | Paper_evidence | WBPaper00004408 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBbt:0006900 | PATO:0000460 | Paper_evidence | WBPaper00004408 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00004408 | ||||||||
| WBPaper00000635 | |||||||||
| WBPaper00001105 | |||||||||
| WBPaper00005609 | |||||||||
| WBPaper00017602 | |||||||||
| Method | Substitution_allele |
