WormBase Tree Display for Variation: WBVar00089535

WBVar00089535 Evidence: Paper_evidence: WBPaper00003738
  Name: Public_name: n488
    Other_name (24)
    HGVSg: CHROMOSOME_V:g.28912_30730del
  Sequence_details: SMap: S_parent: Sequence: B0348
    Flanking_sequences: tttgaaaaagaaaaatgttatgaatgttgt gaataaaaaaaaattaacgtgaaaatgtag
    Mapping_target: B0348
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00026788
    Laboratory: MT
    Status: Live
  Affects: Gene: WBGene00001177
    Transcript (25)
    Interactor: WBInteraction000503975
      WBInteraction000517561
      WBInteraction000517562
      WBInteraction000520752
  Genetics: Interpolated_map_position: V -20.0254
    Mapping_data: In_2_point: 718
  Description: Phenotype (35)
    Phenotype_not_observed: WBPhenotype:0000436 Paper_evidence: WBPaper00040857
        Curator_confirmed: WBPerson712
        Remark: The synaptic vesicle associated protein SNB-1 fused to VENUS was exclusively localized to the presynaptic region of RIA in wild-type and egl-8 mutant animals. | The SYD-2 tagged with GFP was mainly localized to the presynaptic region in wild-type and egl-8 mutant animals. | The GLR-1::GFP was localized to the postsynaptic region in wild-type and egl-8 mutant animals. Paper_evidence: WBPaper00040857
            Curator_confirmed: WBPerson712
      WBPhenotype:0000631 Paper_evidence: WBPaper00040857
        Curator_confirmed: WBPerson712
        Remark: In contrast to the synaptic and thermotaxis phenotypes, mutations in egl-8 did not confer resistance to the developmental defect; treatment of wild-type animals with LiCl substantially shortens the body length of animals; LiCl treatment also shortened the body size of ttx-7 mutants. Paper_evidence: WBPaper00040857
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00003608 Paper_evidence: WBPaper00040857
              Curator_confirmed: WBPerson712
      WBPhenotype:0001182 Paper_evidence: WBPaper00031915
        Curator_confirmed: WBPerson2021
        Remark: Mutants had wild-type fat content Paper_evidence: WBPaper00031915
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: Fat content was visualized by Nile red staining Paper_evidence: WBPaper00031915
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001315 Paper_evidence: WBPaper00035487
        Curator_confirmed: WBPerson2021
        Remark: Whole cell current amplitude was not significantly (P>0.05) different in intestinal cells cultured from wild type and PLC mutant worms Paper_evidence: WBPaper00035487
            Curator_confirmed: WBPerson2021
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00035487
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: C. elegans embryonic cell culture and patch clamp electrophysiology Paper_evidence: WBPaper00035487
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001725 Paper_evidence: WBPaper00033094
        Curator_confirmed: WBPerson2021
        Remark: egl-8 is not required for transgene expression upon osmotic stress Paper_evidence: WBPaper00033094
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Genotype: frIs7 [pnlp-29::GFP] Paper_evidence: WBPaper00033094
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001811 Paper_evidence: WBPaper00031915
        Curator_confirmed: WBPerson2021
        Remark: Mutants were susceptible to the fat-reducing effects of exogenously administered serotonin Paper_evidence: WBPaper00031915
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: Reduced fat content of 5-HT-treated animals was visualized by Nile red staining and confirmed by thin-layer chromatography (TLC) quantitation of total triglycerides extracted from vehicle- and 5-HT-treated worms and by Sudan black fat staining Paper_evidence: WBPaper00031915
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001838 Paper_evidence: WBPaper00033094
        Curator_confirmed: WBPerson2021
        Remark: The PMA-induced upregulation of pnlp-29::GFP expression was normal in mutant worms Paper_evidence: WBPaper00033094
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Genotype: frIs7 [pnlp-29::GFP] Paper_evidence: WBPaper00033094
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001840 Paper_evidence: WBPaper00033094
        Curator_confirmed: WBPerson2021
        Remark: Normal increase in pnlp-29::GFP expression after wounding Paper_evidence: WBPaper00033094
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Genotype: frIs7 [pnlp-29::GFP] Paper_evidence: WBPaper00033094
              Curator_confirmed: WBPerson2021
  Disease_info: Models_disease: DOID:0050742
    Models_disease_in_annotation: WBDOannot00000687
  Reference (12)
  Remark: The egl-8(n488) deletion extends from an intron 212 bp after exon 9 to an intron 434 bp after exon 11 Paper_evidence: WBPaper00003738
  Method: Deletion_allele