WormBase Tree Display for Variation: WBVar00089616
expand all nodes | collapse all nodes | view schema
WBVar00089616 | Evidence | Paper_evidence | WBPaper00032201 | |||||
---|---|---|---|---|---|---|---|---|
Remark | Incorrect location in the paper. Is A135T (GCA to ACA), should be A122T (GCA to ACA . | |||||||
Name | Public_name | n592 | ||||||
Other_name | CE43400:p.Ala122Thr | |||||||
CE04219:p.Ala133Thr | ||||||||
C46F4.1b.1:c.364G>A | ||||||||
C46F4.1a.1:c.397G>A | ||||||||
HGVSg | CHROMOSOME_X:g.5933314G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C46F4 | ||||
Flanking_sequences | TCAGTTGCATTCACAACGACGATCGTTGTC | CAGTGTTTCGGTATTGTGCACTGAAGTTTC | ||||||
Mapping_target | C46F4 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00032201 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00026822 | |||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001175 | ||||||
Transcript | C46F4.1a.1 (12) | |||||||
C46F4.1b.1 (12) | ||||||||
Genetics | Interpolated_map_position | X | -4.03858 | |||||
Mapping_data | In_multi_point | 612 | ||||||
731 | ||||||||
Description | Phenotype (26) | |||||||
Phenotype_not_observed | WBPhenotype:0001336 | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_assay | Treatment | As described in Hodgkin, Horvitz, and Brenner (1979), six L4 males and six L4 dpy-11 hermaphrodites incubated for 24 hours, males removed, and hermaphrodites transferred to fresh dishes each day. Cross-progeny are counted. | Paper_evidence | WBPaper00000635 | ||||
Curator_confirmed | WBPerson48 | |||||||
Reference | WBPaper00043908 | |||||||
WBPaper00032201 | ||||||||
WBPaper00000635 | ||||||||
WBPaper00025924 | ||||||||
WBPaper00019207 | ||||||||
WBPaper00016727 | ||||||||
WBPaper00064746 | ||||||||
Remark | [211216 skd] Mutation site location updated based on sequencing results received from WBPerson51700 by email. Previous location A135T, corrected now to A122T. | Person_evidence | WBPerson51700 | |||||
Curator_confirmed | WBPerson51134 | |||||||
Date_last_updated | 16 Dec 2021 00:31:24 | |||||||
Method | Substitution_allele |