WormBase Tree Display for Variation: WBVar00089677
expand all nodes | collapse all nodes | view schema
WBVar00089677 | Evidence | Paper_evidence | WBPaper00004503 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n691 | |||||||
Other_name | Y47H9C.4b.1:c.783del | ||||||||
Y47H9C.4c.1:c.783del | |||||||||
CE30361:p.Asn261LysfsTer35 | |||||||||
CE30362:p.Asn261LysfsTer35 | |||||||||
CE20264:p.Asn261LysfsTer35 | |||||||||
Y47H9C.4a.1:c.783del | |||||||||
HGVSg | CHROMOSOME_I:g.11863036del | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y47H9C | |||||
Flanking_sequences | ccaaaacggagcaacttgcgacaatacaaa | ggaaaatgtatctgtaaatcaggatatcac | |||||||
Mapping_target | Y47H9C | ||||||||
Type_of_mutation | Deletion | c | Paper_evidence | WBPaper00004503 | |||||
WBPaper00025002 | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026846 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000415 | |||||||
Transcript | Y47H9C.4a.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y47H9C.4a.1:c.783del | ||||||||
HGVSp | CE20264:p.Asn261LysfsTer35 | ||||||||
cDNA_position | 789 | ||||||||
CDS_position | 783 | ||||||||
Protein_position | 261 | ||||||||
Exon_number | 6/13 | ||||||||
Codon_change | aaC/aa | ||||||||
Amino_acid_change | N/X | ||||||||
Y47H9C.4c.1 | VEP_consequence | frameshift_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y47H9C.4c.1:c.783del | ||||||||
HGVSp | CE30362:p.Asn261LysfsTer35 | ||||||||
cDNA_position | 789 | ||||||||
CDS_position | 783 | ||||||||
Protein_position | 261 | ||||||||
Exon_number | 6/12 | ||||||||
Codon_change | aaC/aa | ||||||||
Amino_acid_change | N/X | ||||||||
Y47H9C.4b.1 | VEP_consequence | frameshift_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y47H9C.4b.1:c.783del | ||||||||
HGVSp | CE30361:p.Asn261LysfsTer35 | ||||||||
cDNA_position | 789 | ||||||||
CDS_position | 783 | ||||||||
Protein_position | 261 | ||||||||
Exon_number | 6/13 | ||||||||
Codon_change | aaC/aa | ||||||||
Amino_acid_change | N/X | ||||||||
Genetics | Interpolated_map_position | I | 12.8819 | ||||||
Description | Phenotype | WBPhenotype:0000241 | Paper_evidence | WBPaper00004503 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Cell corpses persisted in the L1 head. No cell corpses were observed in the wild-type L1 head. | Paper_evidence | WBPaper00004503 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00004503 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00001438 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Failure to engulf cell corpses | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001438 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage (2) | |||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00032003 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals died more quickly than wild-type animals when feeding on live S. enterica, strain 1344. | Paper_evidence | WBPaper00032003 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032003 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | A total of 20 ml of culture was plated onto a 3.5 cm plate containing modified NGM (3.5% peptone instead of 2.5%). Synchronized one-day-old adult hermaphroditic nematodes were transferred to lawns of the various bacteria and transferred daily to a fresh lawn until progeny were no longer produced. | Paper_evidence | WBPaper00032003 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00032003 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00032003 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited a reduced life span when grown on live E. coli, stain OP50, compared with wild-type animals. | Paper_evidence | WBPaper00032003 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032003 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00032003 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00004503 | ||||||||
WBPaper00001438 | |||||||||
WBPaper00032003 | |||||||||
Method | Deletion_allele |