WormBase Tree Display for Variation: WBVar00089684
expand all nodes | collapse all nodes | view schema
WBVar00089684 | Evidence | Paper_evidence | WBPaper00002543 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n698 | |||||||
Other_name | Y71F9B.5b.1:c.66+1G>A | ||||||||
Y71F9B.5a.1:c.66+1G>A | |||||||||
Y71F9B.5a.2:c.66+1G>A | |||||||||
HGVSg | CHROMOSOME_I:g.2707695G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y71F9B | |||||
Flanking_sequences | ccactcgccacaggatcaattttcgatcag | tagacttattggaaatctgaaaaatcgatg | |||||||
Mapping_target | Y71F9B | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002543 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026852 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003006 | |||||||
Transcript | Y71F9B.5a.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y71F9B.5a.1:c.66+1G>A | ||||||||
Intron_number | 2/10 | ||||||||
Y71F9B.5b.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y71F9B.5b.1:c.66+1G>A | ||||||||
Intron_number | 2/10 | ||||||||
Y71F9B.5a.2 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y71F9B.5a.2:c.66+1G>A | ||||||||
Intron_number | 3/11 | ||||||||
Interactor | WBInteraction000000820 | ||||||||
WBInteraction000524002 | |||||||||
WBInteraction000524003 | |||||||||
WBInteraction000524042 | |||||||||
WBInteraction000538570 | |||||||||
WBInteraction000538577 | |||||||||
Genetics | Interpolated_map_position | I | -7.44605 | ||||||
Description | Phenotype | WBPhenotype:0000257 | Paper_evidence | WBPaper00002543 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult hermaphrodites exhibited phasmid defects as assayed by DiO dye-filling. | Paper_evidence | WBPaper00002543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00003453 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | lin-17(n698) confers a SPD sheath to neuron fate transformation (Table 1) | Paper_evidence | WBPaper00003453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005831 | PATO:0000460 | Paper_evidence | WBPaper00003453 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000691 | Paper_evidence | WBPaper00003453 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | 8% of lin-17(n698) hermaphrodite animals have a gonad defect (defined as abnormal gonad morphology, single gonadal arm, and ectopic meiosis at L4 stage) (Table 2). | Paper_evidence | WBPaper00003453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00003453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00003453 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Single protrusion posterior to the vulva | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000828 | Paper_evidence | WBPaper00003453 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | 73% of lin-17(n698) animals have abnormal phasmids, as determined by DiO filling assay, indicative of a T-lineage defect. | Paper_evidence | WBPaper00003453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005425 | PATO:0000460 | Paper_evidence | WBPaper00003453 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | L3 and L4 stage worms were tested by DiO filling of amphids and phasmids, as described by Herman and Horvitz (1994). Animals that showed positive for amphid filling and negative for phasmid filling were scored as phasmid defective. | Paper_evidence | WBPaper00003453 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00003453 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Using a weak lin-17 allele, n698, wherein the first B cell division is usually not disrupted, we found that 80% of the animals show two cells per spicule (one neuron, one sheath) expressing the SPD marker gpa-1::lacZ (Fig. 2D; Table 1), as opposed to just one cell (SPD neuron) in wild type animals | Paper_evidence | WBPaper00003453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
In the lin-17(n698) mutant, osm-6::GFP is expressed in an extra cell associated with the spicules (four of six animals examined), consistent with the extra expression observed with the gpa-1::lacZ marker. | Paper_evidence | WBPaper00003453 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005831 | PATO:0000460 | Paper_evidence | WBPaper00003453 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | syIs20[gpa-1::lacZ+dpy-20(+)] (marker for male spicules and phasmid neurons) | Paper_evidence | WBPaper00003453 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
osm-6::GFP (marker expressed in SPD and SPV neurons of wild type spicules and in male sensory ray neurons) | Paper_evidence | WBPaper00003453 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001355 | Paper_evidence | WBPaper00005832 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 2 | Paper_evidence | WBPaper00005832 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | 6 | Paper_evidence | WBPaper00005832 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00005832 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001681 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | abnormal spindle orientation of Bγ | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007830 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0000132 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
GO:0005819 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0002011 | Paper_evidence | WBPaper00003453 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | 2% of lin-17(n698) animals have a bivulva phenotype (Table 2) | Paper_evidence | WBPaper00003453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00003453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00003453 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000099 | Paper_evidence | WBPaper00003453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | lin-17(n698) animals did not exhibit a P12 fate specification defect | Paper_evidence | WBPaper00003453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00003453 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | No alteration in syIs45 expression | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007830 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
WBbt:0008451 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0010467 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00003453 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Expression of a socket cell marker, egl-17::GFP, was not affected by the lin-17(n698) mutation (n = 10), suggesting that the socket cells are correctly specified in lin-17(n698) mutants. | Paper_evidence | WBPaper00003453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005750 | PATO:0000460 | Paper_evidence | WBPaper00003453 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | egl-17::GFP (socket cell marker) | Paper_evidence | WBPaper00003453 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00003453 | ||||||||
WBPaper00035553 | |||||||||
WBPaper00000762 | |||||||||
WBPaper00005832 | |||||||||
WBPaper00002543 | |||||||||
WBPaper00017527 | |||||||||
Method | Substitution_allele |