WormBase Tree Display for Variation: WBVar00089790
expand all nodes | collapse all nodes | view schema
| WBVar00089790 | Evidence | Paper_evidence | WBPaper00004809 | |||||
|---|---|---|---|---|---|---|---|---|
| WBPaper00050739 | ||||||||
| Name | Public_name | n822 | ||||||
| Other_name | CE28995:p.Cys225Ter | |||||||
| Y54E10BR.7.1:c.675T>A | ||||||||
| HGVSg | CHROMOSOME_I:g.3042495A>T | |||||||
| Sequence_details | SMap | S_parent | Sequence | Y54E10BR | ||||
| Flanking_sequences | tgagcatctcggtgtattccacggattgcc | catgacgcccacggaacttcggaatcccaa | ||||||
| Mapping_target | Y54E10BR | |||||||
| Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | |||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00006656 | |||||||
| WBStrain00027352 | ||||||||
| Laboratory | MT | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00003387 | ||||||
| Transcript | Y54E10BR.7.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | |||||||
| HGVSc | Y54E10BR.7.1:c.675T>A | |||||||
| HGVSp | CE28995:p.Cys225Ter | |||||||
| cDNA_position | 675 | |||||||
| CDS_position | 675 | |||||||
| Protein_position | 225 | |||||||
| Exon_number | 6/13 | |||||||
| Codon_change | tgT/tgA | |||||||
| Amino_acid_change | C/* | |||||||
| Genetics | Interpolated_map_position | I | -4.51272 | |||||
| Description | Phenotype (20) | |||||||
| Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00036766 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Mutants grown on NGM plates exhibited superficially normal locomotion. | Paper_evidence | WBPaper00036766 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0001462 | Paper_evidence | WBPaper00032335 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Animals exhibited wild-type chemotaxis to NaCl. | Paper_evidence | WBPaper00032335 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl. | Paper_evidence | WBPaper00032335 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0001817 | Paper_evidence | WBPaper00032335 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Animals exhibited enhanced-gustatory plasticity, i.e. strong avoidance to NaCl after starvation, similar to that observed for wild type. | Paper_evidence | WBPaper00032335 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Reference | WBPaper00043908 | |||||||
| WBPaper00036766 | ||||||||
| WBPaper00032335 | ||||||||
| WBPaper00050739 | ||||||||
| Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | ||||||
| Method | Substitution_allele |
