WormBase Tree Display for Variation: WBVar00089844
expand all nodes | collapse all nodes | view schema
WBVar00089844 | Evidence | Paper_evidence | WBPaper00004314 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | ZK637 | |||||
Flanking_sequences | tttgctccgatataagaaagctcgtcaatg | gtcatgtgcgagttcttctattctgcaatc | |||||||
Mapping_target | ZK637 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027205 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002998 | |||||||
Transcript | ZK637.7b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK637.7b.1:c.660G>A | ||||||||
HGVSp | CE28195:p.Trp220Ter | ||||||||
cDNA_position | 666 | ||||||||
CDS_position | 660 | ||||||||
Protein_position | 220 | ||||||||
Exon_number | 5/11 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
ZK637.7a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK637.7a.1:c.654G>A | ||||||||
HGVSp | CE28194:p.Trp218Ter | ||||||||
cDNA_position | 660 | ||||||||
CDS_position | 654 | ||||||||
Protein_position | 218 | ||||||||
Exon_number | 5/11 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000502685 | ||||||||
WBInteraction000502687 | |||||||||
WBInteraction000502690 | |||||||||
WBInteraction000518982 | |||||||||
Genetics | Interpolated_map_position | III | -0.00581872 | ||||||
Mapping_data | In_multi_point | 758 | |||||||
759 | |||||||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00004314 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Brood size is reduced compared to wild-type | Paper_evidence | WBPaper00004314 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000351 | Paper_evidence | WBPaper00004314 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | 71% of fertilized eggs in lin-9(n942) hermaphrodites arrested as embryos and failed to hatch | Paper_evidence | WBPaper00004314 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00004314 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000399 | Paper_evidence | WBPaper00004314 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The presence of sperm in the body cavity and/or distal gonad demonstrates that the structural integrity of the hermaphrodite gonad is compromised | Paper_evidence | WBPaper00004314 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004314 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000443 | Paper_evidence | WBPaper00004314 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The copulatory spicules were crumpled and often reduced in size | Paper_evidence | WBPaper00004314 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005312 | PATO:0000460 | Paper_evidence | WBPaper00004314 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00004314 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000668 | Paper_evidence | WBPaper00004314 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Hermaphrodites had endomitotic oocytes within the proximal oviduct | Paper_evidence | WBPaper00004314 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004314 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Sterile non-Muv alone | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000867 | Paper_evidence | WBPaper00004314 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | 71% of fertilized eggs in lin-9(n942) hermaphrodites arrested as embryos and failed to hatch | Paper_evidence | WBPaper00004314 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00004314 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000977 | Paper_evidence | WBPaper00004314 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | lin-9(n942) hermaphrodite gonads contained four instead of eight sheath cells | Paper_evidence | WBPaper00004314 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005828 | PATO:0000460 | Paper_evidence | WBPaper00004314 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004314 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Gonads were dissected and stained with an anti-CEH-18 antibody | Paper_evidence | WBPaper00004314 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001509 | Paper_evidence | WBPaper00004314 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The tails of lin-9(n942) mutant males had fewer than half the normal number of sensory rays | Paper_evidence | WBPaper00004314 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00004314 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00004314 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001675 | Paper_evidence | WBPaper00004314 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In many lin-9(n942) males, spermatids entered the space between the gonadal basement membrane and the germline epithelium and slipped back distally, away from the seminal vesicle | Paper_evidence | WBPaper00004314 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00004314 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000700 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Non-Muv alone. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000983 | Paper_evidence | WBPaper00004314 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Small brood size does not result from a failure to make functional sperm, because mating wild-type males with lin-9(n942) hermaphrodites did not dramatically increase the brood size | Paper_evidence | WBPaper00004314 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00014474 | ||||||||
WBPaper00004314 | |||||||||
Method | Substitution_allele |