WormBase Tree Display for Variation: WBVar00089920
expand all nodes | collapse all nodes | view schema
WBVar00089920 | Name | Public_name | n1047 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE31440:p.Tyr126Phe | ||||||||
C37F5.1a.1:c.377A>T | |||||||||
CE27833:p.Tyr86Phe | |||||||||
C37F5.1b.1:c.257A>T | |||||||||
HGVSg | CHROMOSOME_IV:g.2278917T>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C37F5 | |||||
Flanking_sequences | ctcaccttcttaataatattcttctcataa | aatatcgtaacgctctcgacagtttatcat | |||||||
Mapping_target | C37F5 | ||||||||
Type_of_mutation | Substitution | t | a | Curator_confirmed | WBPerson4055 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026933 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00305307 | |||||||
WBGene00002990 | |||||||||
Transcript | C37F5.1a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | C37F5.1a.1:c.377A>T | ||||||||
HGVSp | CE31440:p.Tyr126Phe | ||||||||
cDNA_position | 377 | ||||||||
CDS_position | 377 | ||||||||
Protein_position | 126 | ||||||||
Exon_number | 3/7 | ||||||||
Codon_change | tAt/tTt | ||||||||
Amino_acid_change | Y/F | ||||||||
C37F5.1b.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | C37F5.1b.1:c.257A>T | ||||||||
HGVSp | CE27833:p.Tyr86Phe | ||||||||
cDNA_position | 265 | ||||||||
CDS_position | 257 | ||||||||
Protein_position | 86 | ||||||||
Exon_number | 2/6 | ||||||||
Codon_change | tAt/tTt | ||||||||
Amino_acid_change | Y/F | ||||||||
C37F5.2 | |||||||||
Interactor | WBInteraction000052422 | ||||||||
WBInteraction000500300 | |||||||||
Genetics | Interpolated_map_position | IV | -8.47616 | ||||||
Description | Phenotype | WBPhenotype:0000700 | Paper_evidence | WBPaper00000762 | |||||
WBPaper00036232 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Penetrance | Complete | Paper_evidence | WBPaper00036232 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00000762 | ||||||||
WBPaper00036232 | |||||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||||
Method | Substitution_allele |