WormBase Tree Display for Variation: WBVar00089926
expand all nodes | collapse all nodes | view schema
WBVar00089926 | Evidence | Paper_evidence | WBPaper00004442 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1053 | |||||||
Other_name | CE12098:p.Trp57Ter | ||||||||
K10G6.1.1:c.170G>A | |||||||||
HGVSg | CHROMOSOME_II:g.3983457G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | K10G6 | |||||
Flanking_sequences | aaatcagctcaaaatgtaatgttttcaggt | gcaaaactccctgcgacacaacttgtcatt | |||||||
Mapping_target | K10G6 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026935 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003017 | |||||||
Transcript | K10G6.1.1 | VEP_consequence | stop_gained,splice_region_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | K10G6.1.1:c.170G>A | ||||||||
HGVSp | CE12098:p.Trp57Ter | ||||||||
cDNA_position | 275 | ||||||||
CDS_position | 170 | ||||||||
Protein_position | 57 | ||||||||
Exon_number | 3/6 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000502310 | ||||||||
WBInteraction000502390 | |||||||||
WBInteraction000520759 | |||||||||
WBInteraction000521357 | |||||||||
WBInteraction000521360 | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | II | -5.88222 | ||||||
Description | Phenotype | WBPhenotype:0000218 | Paper_evidence | WBPaper00026707 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 4.3 (n=31) | Paper_evidence | WBPaper00026707 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000220 | Paper_evidence | WBPaper00003200 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Vulval precursor cells are defective in the specification of the primary, secondary and tertiary cell fates during the L3 stage (Table 1). | Paper_evidence | WBPaper00003200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00003200 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00003200 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00026707 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 30% (n=230) | Paper_evidence | WBPaper00026707 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00000762 | |||||||
WBPaper00026707 | |||||||||
WBPaper00003200 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Remark (2) | |||||||||
Penetrance | Incomplete | 76% (n=329) | Paper_evidence | WBPaper00026707 | |||||
Curator_confirmed | WBPerson712 | ||||||||
High | 88% penetrance | Paper_evidence | WBPaper00003200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00003200 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00003200 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00027035 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We introduced deIs1 and deIs4 into a lin-31(n1053) null mutant background and analyzed GFP expression. Surprisingly, we found that GFP expression increased in P6.p from both reporters after vulval induction in lin-31(n1053) animals (Fig. 9C and data not shown)." | Paper_evidence | WBPaper00027035 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00027035 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | lin-39::GFP | Paper_evidence | WBPaper00027035 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000363 | Paper_evidence | WBPaper00026707 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lin-31(lf) does not cause a delay in vulval cell division. | Paper_evidence | WBPaper00026707 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00026707 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00003200 | ||||||||
WBPaper00027035 | |||||||||
WBPaper00026707 | |||||||||
WBPaper00000762 | |||||||||
WBPaper00014517 | |||||||||
Method | Substitution_allele |