WormBase Tree Display for Variation: WBVar00090278

WBVar00090278 Evidence: Paper_evidence: WBPaper00003566
  Name: Public_name: n1853
    Other_name: C09H6.2c.1:c.2233A>T
      C09H6.2b.1:c.2302A>T
      CE15610:p.Lys796Ter
      C09H6.2a.1:c.2386A>T
      CE42752:p.Lys745Ter
      CE27060:p.Lys768Ter
    HGVSg: CHROMOSOME_I:g.8111279T>A
  Sequence_details: SMap: S_parent: Sequence: C09H6
    Flanking_sequences: tttggtacaacaacttctttttgagtttctt ctttgcaaacatttcaagctcatcaccaaga
    Mapping_target: C09H6
    Type_of_mutation: Substitution: t a Curator_confirmed: WBPerson4055
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00027131
    Laboratory: MT
    Status: Live
  Affects: Gene: WBGene00002999
    Transcript: C09H6.2c.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C09H6.2c.1:c.2233A>T
        HGVSp: CE42752:p.Lys745Ter
        cDNA_position: 2233
        CDS_position: 2233
        Protein_position: 745
        Exon_number: 13/15
        Codon_change: Aaa/Taa
        Amino_acid_change: K/*
      C09H6.2b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C09H6.2b.1:c.2302A>T
        HGVSp: CE27060:p.Lys768Ter
        cDNA_position: 2305
        CDS_position: 2302
        Protein_position: 768
        Exon_number: 14/17
        Codon_change: Aaa/Taa
        Amino_acid_change: K/*
      C09H6.2a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C09H6.2a.1:c.2386A>T
        HGVSp: CE15610:p.Lys796Ter
        cDNA_position: 2387
        CDS_position: 2386
        Protein_position: 796
        Exon_number: 15/18
        Codon_change: Aaa/Taa
        Amino_acid_change: K/*
  Genetics: Interpolated_map_position: I 2.54604
  Description: Phenotype: WBPhenotype:0000112 Paper_evidence: WBPaper00003566
        Curator_confirmed: WBPerson2021
        Remark: In protein extracts from lin-10(n1853) animals, anti-LIN-10 antibodies detect a new band at 120 kDa but do not detect either the 140- or 70-kDa band observed in protein extracts from wild-type animals. Paper_evidence: WBPaper00003566
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: Western blotting experiments using anti-LIN-10 antibodies Paper_evidence: WBPaper00003566
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000698 Paper_evidence: WBPaper00003566
        Curator_confirmed: WBPerson2021
        Remark: lin-10(n1853) results in a weak vulvaless phenotype Paper_evidence: WBPaper00003566
            Curator_confirmed: WBPerson2021
        Penetrance: Incomplete: 15 percent Vul Paper_evidence: WBPaper00003566
              Curator_confirmed: WBPerson2021
  Reference: WBPaper00003566
  Remark: Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues.
    [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand Curator_confirmed: WBPerson4055
  Method: Substitution_allele