WormBase Tree Display for Variation: WBVar00090303
expand all nodes | collapse all nodes | view schema
WBVar00090303 | Name | Public_name | n1939 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | T01C4.2c.1:c.110G>A | ||||||||
CE28350:p.Trp37Ter | |||||||||
HGVSg | CHROMOSOME_V:g.7103806G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T01C4 | |||||
Flanking_sequences | cggcacgtgaaagatcgaatacagaatatt | gaaagatcagcatccacaacaaagatggag | |||||||
Mapping_target | T01C4 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003849 | |||||||
Transcript | T01C4.2c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T01C4.2c.1:c.110G>A | ||||||||
HGVSp | CE28350:p.Trp37Ter | ||||||||
cDNA_position | 215 | ||||||||
CDS_position | 110 | ||||||||
Protein_position | 37 | ||||||||
Exon_number | 3/8 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | V | 0.586803 | ||||||
Mapping_data | In_multi_point | 2049 | |||||||
In_pos_neg_data | 5974 | ||||||||
5978 | |||||||||
5981 | |||||||||
Description | Phenotype | WBPhenotype:0000302 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Benzaldehyde dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000304 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Isoamyl alcohol dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001048 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Defective chemotaxis to some volatile odorants. n1939/Df similar. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000303 | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Diacetyl dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000480 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00005360 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Pyrazine dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001085 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 2-butanone dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001086 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Trimethylthiazole dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001248 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No morphological defects in the AWC cilia | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001786 | ||||||||
WBPaper00021697 | |||||||||
Remark | Corresponding predicted gene has also been called T01C4.2b | Paper_evidence | WBPaper00004498 | ||||||
Method | Substitution_allele |