WormBase Tree Display for Variation: WBVar00090317

WBVar00090317 Evidence: Paper_evidence: WBPaper00002151
  Name: Public_name: n1989
    Other_name: CE25437:p.Ser217Phe
      Y54E10BL.6.1:c.650C>T
    HGVSg: CHROMOSOME_I:g.3008792G>A
  Sequence_details: SMap: S_parent: Sequence: Y54E10BL
    Flanking_sequences: gagaaattaaattatgcgattttggagtct tggaatgttgattgattcgatggccaactc
    Mapping_target: Y54E10BL
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00002151
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00027333
    Laboratory: MT
    Status: Live
  Affects: Gene: WBGene00003186
    Transcript: Y54E10BL.6.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: Y54E10BL.6.1:c.650C>T
        HGVSp: CE25437:p.Ser217Phe
        cDNA_position: 653
        CDS_position: 650
        Protein_position: 217
        Exon_number: 6/9
        Codon_change: tCt/tTt
        Amino_acid_change: S/F
  Isolation: Mutagen: EMS Paper_evidence: WBPaper00002151
  Genetics: Interpolated_map_position: I -5.2368
  Description: Phenotype: WBPhenotype:0000386 Paper_evidence: WBPaper00033433
        Curator_confirmed: WBPerson2987
        Remark: Copper-induced germ cell apoptosis was abolished in mek-2(n1989) mutants (Figure 4). Paper_evidence: WBPaper00033433
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00002862 Paper_evidence: WBPaper00033433
              Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: Worms were exposed to 10 micromolar of copper for 12 hours Paper_evidence: WBPaper00033433
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000411 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: homozygous viable but much early larval lethality, rod-like morphology Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000651 Paper_evidence: WBPaper00024311
        Curator_confirmed: WBPerson712
        Remark: Animals become severely constipated compared to wild-type worms when grown on lawns of M. nematophilum, whereas they are not constipated when grown on standard E. coli food source, OP50. Paper_evidence: WBPaper00024311
            Curator_confirmed: WBPerson712
        Penetrance: High: 93% Paper_evidence: WBPaper00024311
              Curator_confirmed: WBPerson712
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00024311
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were grown on NGM plates seeded with trace (usually 0.01% (v/v)) M. nematophilum in OP50. Strains were cultured on these plates at 25*C. Paper_evidence: WBPaper00024311
              Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: weak alleles Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001013 Paper_evidence: WBPaper00024311
          WBPaper00033445
        Curator_confirmed: WBPerson712
          WBPerson2021
        Remark: The severety of constipation induced in animals grown in the presence of M. nematophilum suggests these animals are hypersensitive to infection by this pathogen. Paper_evidence: WBPaper00024311
            Curator_confirmed: WBPerson712
          mek-2 mutants that were deficient in the Dar response showed enhanced susceptibility to yeast killing compared to wild-type C. elegans on yeast Paper_evidence: WBPaper00033445
            Curator_confirmed: WBPerson2021
        Penetrance: High: Paper_evidence: WBPaper00024311
              Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00033445
            Curator_confirmed: WBPerson2021
          Hypomorph_reduction_of_function: Paper_evidence: WBPaper00024311
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were grown on NGM plates seeded with trace (usually 0.01% (v/v)) M. nematophilum in OP50. Strains were cultured on these plates at 25*C. Paper_evidence: WBPaper00024311
              Curator_confirmed: WBPerson712
      WBPhenotype:0001413 Paper_evidence: WBPaper00024311
        Curator_confirmed: WBPerson712
        Remark: Animals failed to swell when exposed to Microbacterium nematophilum, although bacteria were present in the rectum of these animals. Bacteria were visualized by nucleic acid dye SYTO 13. Paper_evidence: WBPaper00024311
            Curator_confirmed: WBPerson712
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00024311
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were grown on NGM plates seeded with trace (usually 0.01% (v/v)) M. nematophilum in OP50. Strains were cultured on these plates at 25*C. Paper_evidence: WBPaper00024311
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000386 Paper_evidence: WBPaper00035318
        Curator_confirmed: WBPerson2987
        Remark: Cobalt-induced germline cell apoptosis was unaffected in mek-2(n1989) mutants (Figure 3) Paper_evidence: WBPaper00035318
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00003058 Paper_evidence: WBPaper00035318
              Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: Synchronized young adult hermaphrodites were treated in K-medium with 0.01 millimolar Cobalt chloride for 12 hours, and apoptotic cells were scored after AO staining. Paper_evidence: WBPaper00035318
              Curator_confirmed: WBPerson2987
  Reference: WBPaper00023380
    WBPaper00033433
    WBPaper00024311
    WBPaper00035318
    WBPaper00033445
  Method: Substitution_allele