WormBase Tree Display for Variation: WBVar00090323
expand all nodes | collapse all nodes | view schema
WBVar00090323 | Evidence | Paper_evidence | WBPaper00003091 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1997 | |||||||
Other_name | C48B4.4b.1:c.3232C>T | ||||||||
C48B4.4a.2:c.3226C>T | |||||||||
C48B4.4a.1:c.3226C>T | |||||||||
C48B4.4d.1:c.3433C>T | |||||||||
CE20575:p.Arg1145Cys | |||||||||
CE24857:p.Arg1078Cys | |||||||||
C48B4.4c.1:c.3271C>T | |||||||||
CE24856:p.Arg1076Cys | |||||||||
CE27867:p.Arg1091Cys | |||||||||
HGVSg | CHROMOSOME_III:g.9573298G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C48B4 | |||||
Flanking_sequences | ccgacacttatcagcatgattaatagagct | gtctaaccggtactgtagatgctgaaatta | |||||||
Mapping_target | C48B4 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003091 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027180 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000421 | |||||||
Transcript | C48B4.4b.1 (12) | ||||||||
C48B4.4d.1 (12) | |||||||||
C48B4.4c.1 (12) | |||||||||
C48B4.4a.2 (12) | |||||||||
C48B4.4a.1 (12) | |||||||||
Genetics | Interpolated_map_position | III | 0.645793 | ||||||
Description | Phenotype | WBPhenotype:0000885 | Paper_evidence | WBPaper00001438 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Failure to engulf cell corpses | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001438 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005739 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001438 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000037 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
Phenotype_not_observed | WBPhenotype:0001208 | Paper_evidence | WBPaper00027644 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Animals were not resistant to RNAi as assayed on either pop-1 RNAi or unc-22 RNAi. | Paper_evidence | WBPaper00027644 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Animals reared on both pop-1 and unc-22 feeding plates at 15, 20, 25, and 26C. | Paper_evidence | WBPaper00027644 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Reference | WBPaper00003091 | ||||||||
WBPaper00001438 | |||||||||
WBPaper00022142 | |||||||||
WBPaper00027644 | |||||||||
Method | Substitution_allele |