WormBase Tree Display for Variation: WBVar00090360
expand all nodes | collapse all nodes | view schema
WBVar00090360 | Evidence | Paper_evidence | WBPaper00001786 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n2148 | |||||||
Other_name | T01C4.2a.1:c.284G>A | ||||||||
CE28349:p.Gly99Asp | |||||||||
CE28350:p.Gly123Asp | |||||||||
T01C4.2b.1:c.296G>A | |||||||||
T01C4.2c.1:c.368G>A | |||||||||
CE28348:p.Gly95Asp | |||||||||
HGVSg | CHROMOSOME_V:g.7113209G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T01C4 | |||||
Flanking_sequences | tagggaggcggcgacacggttacatgcggg | ttgcttatcggatttgcatggttacaatca | |||||||
Mapping_target | T01C4 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004498 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003849 | |||||||
Transcript | T01C4.2b.1 (12) | ||||||||
T01C4.2c.1 (12) | |||||||||
T01C4.2a.1 (12) | |||||||||
Genetics | Interpolated_map_position | V | 0.591604 | ||||||
Mapping_data | In_multi_point | 2051 | |||||||
In_pos_neg_data | 5973 | ||||||||
5976 | |||||||||
5979 | |||||||||
Description | Phenotype | WBPhenotype:0000302 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Benzaldehyde dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000304 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Isoamyl alcohol dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000303 | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Diacetyl dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000480 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00005360 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Pyrazine dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001085 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 2-butanone dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001086 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Trimethylthiazole dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001248 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No morphological defects in the AWC cilia | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001786 | ||||||||
Method | Substitution_allele |