WormBase Tree Display for Variation: WBVar00090363
expand all nodes | collapse all nodes | view schema
WBVar00090363 | Name | Public_name | n2161 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T07C4.8.1:c.514-1G>A | |||||||
HGVSg | CHROMOSOME_III:g.10336263G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | T07C4 | ||||
Flanking_sequences | acgaattaaattgcaaatttctaattttca | ataggtctaatctcgttcggcggtttcgta | ||||||
Mapping_target | T07C4 | |||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson566 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027213 | |||||||
WBStrain00027218 | ||||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Linked_to | WBVar00090307 | |||||||
Affects | Gene | WBGene00000423 | ||||||
Transcript | T07C4.8.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T07C4.8.1:c.514-1G>A | |||||||
Intron_number | 2/4 | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | III | 2.35728 | |||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson566 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Maternal effect lethality. Isolation described in Hengartner, Ellis, and Horvitz, Nature 356:494-499, 1992 (WBPaper00001529). Mutation sequenced by Brendan Galvin. In some assays, ced-9(n1950 n2161) is not as strong a loss-of-function mutation as ced-9(n2812). Isolated as a cis-suppressor of ced-9(n1950gf) and linked to unc-69(e587). | Person_evidence | WBPerson566 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Person_evidence | WBPerson566 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Person_evidence | WBPerson566 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson566 | |||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | ||||||||
Phenotype_assay | Genotype | unc-69(e587) ced-9(n1950 n2161); ced-3(n717) | Person_evidence | WBPerson566 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001172 | Person_evidence | WBPerson566 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Ectopic cell death. Isolation described in Hengartner, Ellis, and Horvitz, Nature 356:494-499, 1992 (WBPaper00001529). Mutation sequenced by Brendan Galvin. In some assays, ced-9(n1950 n2161) is not as strong a loss-of-function mutation as ced-9(n2812). Isolated as a cis-suppressor of ced-9(n1950gf) and linked to unc-69(e587). | Person_evidence | WBPerson566 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Person_evidence | WBPerson566 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Person_evidence | WBPerson566 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson566 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | unc-69(e587) ced-9(n1950 n2161); ced-3(n717) | Person_evidence | WBPerson566 | ||||
Curator_confirmed | WBPerson712 | |||||||
Method | Substitution_allele |