WormBase Tree Display for Variation: WBVar00090544
expand all nodes | collapse all nodes | view schema
WBVar00090544 | Evidence | Paper_evidence | WBPaper00002151 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n2678 | |||||||
Other_name | Y54E10BL.6.1:c.637G>A | ||||||||
CE25437:p.Asp213Asn | |||||||||
HGVSg | CHROMOSOME_I:g.3008805C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y54E10BL | |||||
Flanking_sequences | gtcaatagtaacggagaaattaaattatgc | attttggagtctctggaatgttgattgatt | |||||||
Mapping_target | Y54E10BL | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002151 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027334 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003186 | |||||||
Transcript | Y54E10BL.6.1 (12) | ||||||||
Interactor | WBInteraction000519063 | ||||||||
WBInteraction000556850 | |||||||||
WBInteraction000556856 | |||||||||
WBInteraction000556859 | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002151 | |||||
Genetics | Interpolated_map_position | I | -5.23678 | ||||||
Mapping_data | In_multi_point | 3202 | |||||||
3204 | |||||||||
Description | Phenotype | WBPhenotype:0000146 | Paper_evidence | WBPaper00049050 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To assess the involvement of the Raf pathway in temperature memory variability in AFD, we analyzed temperature-evoked calcium dynamics of AFD in the Raf pathway mutants: lin-45, mek-2, mpk-1, and sur-2. Surprisingly, mutations in Raf pathway genes reduced the variability of response temperatures of AFD. The wild-type response temperatures distributed within a temperature range of about 19.0 degrees Celsius to 22.0 degrees Celsius. By contrast, the response temperatures of the Raf pathway mutants were within a temperature range of about 20.5 degrees Celsius to 21.5 degrees Celsius (Figures 3B and 3C)." | Paper_evidence | WBPaper00049050 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00049050 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | njEx359[gcy-8p::GCaMP3, gcy-8p::TagRFP]; n2678 balanced with hT2[qIs48]; Parent strain: IK1776 | Paper_evidence | WBPaper00049050 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001060 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001063 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00005086 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00002087 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00004538 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001061 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00004538 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001084 | Paper_evidence | WBPaper00003955 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00057074 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | neurons did not show a loss in unc-25::GFP expression | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014913 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005027 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005021 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00003955 | ||||||||
WBPaper00002151 | |||||||||
WBPaper00049050 | |||||||||
WBPaper00057074 | |||||||||
Method | Substitution_allele |