WormBase Tree Display for Variation: WBVar00090710
expand all nodes | collapse all nodes | view schema
WBVar00090710 | Evidence | Paper_evidence | WBPaper00027336 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n3441 | |||||||
Other_name | CE46695:p.Trp534Ter | ||||||||
Y71G12B.9b.1:c.1601G>A | |||||||||
CE39067:p.Trp534Ter | |||||||||
Y71G12B.9a.1:c.1601G>A | |||||||||
HGVSg | CHROMOSOME_I:g.1763192G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y71G12B | |||||
Flanking_sequences | caagtaccggccttccggcaacagtcagat | ggaagcaattccaccgccaaaaaatccgaa | |||||||
Mapping_target | Y71G12B | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00027336 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027427 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00022149 | |||||||
Transcript | Y71G12B.9b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y71G12B.9b.1:c.1601G>A | ||||||||
HGVSp | CE46695:p.Trp534Ter | ||||||||
cDNA_position | 1601 | ||||||||
CDS_position | 1601 | ||||||||
Protein_position | 534 | ||||||||
Exon_number | 5/5 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Y71G12B.9a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y71G12B.9a.1:c.1601G>A | ||||||||
HGVSp | CE39067:p.Trp534Ter | ||||||||
cDNA_position | 1602 | ||||||||
CDS_position | 1601 | ||||||||
Protein_position | 534 | ||||||||
Exon_number | 6/10 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor (13) | |||||||||
Genetics | Interpolated_map_position | I | -12.9068 | ||||||
Description | Phenotype | WBPhenotype:0000114 | Paper_evidence | WBPaper00050412 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In the absence of lin-65 and met-2, many cco-1-regulated genes exhibited wide variance in expression patterns and failed to become significantly changed from their expression on empty vector. In fact, a majority of the gene expression changes (884 upregulated genes and 380 downregulated genes) induced by cco-1 RNAi were abrogated in lin-65 or met-2 mutant animals (Figures 5A, S6A, and S6B; Table S2)" | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | cco-1(RNAi) | Paper_evidence | WBPaper00050412 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To understand the interdependency of DVE-1 and LIN-65 in response to mitochondrial stress, we performed epistasis analysis in lin-65(n3441) animals carrying a dve-1p::dve-1::gfp reporter and fed cco-1 RNAi. Strikingly, lin-65 mutants abolished DVE-1::GFP nuclear accumulation in cco-1 RNAi-treated animals (Figure 4B). This phenotype was rescued by expression of lin-65 with either its own promoter or an intestinal-specific gly-19 promoter (Figures S4A and S4B)." | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"In comparison, the intensity of nuclear DVE-1::GFP signal decreased in both lin-65 and met-2 animals fed cco-1 RNAi (Figure S4D) and fewer cells contained detectable DVE-1::GFP puncta (Figures 4E and S4D)." | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00023665 | ||||||||
EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO:0005634 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | zcIs39 [dve-1p::dve-1::gfp]; cco-1(RNAi) | Paper_evidence | WBPaper00050412 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Both lin-65 and met-2 animals are short-lived under normal conditions." (Figure 6C) | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"As predicted, both lin-65(n3441) and met-2(ok2307) only partially suppressed the lifespan extension of cco-1 RNAi-treated animals (Figures 6C and 6D; Table S1)." | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | cco-1(RNAi) | Paper_evidence | WBPaper00050412 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00044613 | |||||||
Curator_confirmed | WBPerson24243 | ||||||||
Remark | VC1, VC2, VC3, and VC6 ectopically express the VC4/VC5-specific gene unc-4; uIs45 [unc-4p::MDM2::GFP] was used as the reporter for unc-4. | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004621 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004619 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004618 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004611 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
Phenotype_assay | Genotype | uIs45 [unc-4p::MDM2::GFP] | Paper_evidence | WBPaper00044613 | |||||
Curator_confirmed | WBPerson24243 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Using the characterized lin-65 mutant allele n3441, we confirmed that lin-65 is required for the UPRmt in response to rgef-1p::Q40::yfp expression (Figure 1A)." | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Western blot analyses confirmed the loss of hsp-6p::gfp expression in lin-65 mutants, while PolyQ expression remained unaffected (Figure 1B)." | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"The lin-65 mutation strongly attenuated the upregulation of the UPRmt in animals fed RNAi targeting the cytochrome c oxidase-1 subunit Vb/COX4 of the electron transport chain, cco-1, or animals fed RNAi targeting phb-2, the ortholog of prohibitin PHB2 (Figure S1B)." | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"To further explore the role of LIN-65 in mediating the DVE-1 nuclear signal, we asked if LIN-65 also plays a role in regulating DVE-1 protein levels. Western blot analyses confirmed that DVE-1::GFP protein levels decreased in lin-65 animals when cco-1 RNAi was applied (Figure 4D)." | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00023665 | ||||||||
EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | zcs13 [hsp-6p::GFP]; rmIs101 [rgef-1p::Q40::YFP] | Paper_evidence | WBPaper00050412 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
zcs13 [hsp-6p::GFP] | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
zcIs13 [hsp-6p::GFP]; cco-1(RNAi) | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
zcIs13 [hsp-6p::GFP]; phb-2(RNAi) | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
zcIs39 [dve-1p::dve-1::gfp]; cco-1(RNAi) | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001510 | Paper_evidence | WBPaper00044613 | |||||||
Curator_confirmed | WBPerson24243 | ||||||||
Remark | VC1, VC2, VC3, and VC6 ectopically express the VC4/VC5-specific gene unc-4; uIs45 [unc-4p::MDM2::GFP] was used as the reporter for unc-4. | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004621 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004619 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004618 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004611 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
Phenotype_assay | Genotype | uIs45 [unc-4p::MDM2::GFP] | Paper_evidence | WBPaper00044613 | |||||
Curator_confirmed | WBPerson24243 | ||||||||
WBPhenotype:0001567 | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Surprisingly, we also observed striking changes in chromatin structure in intestinal nuclei on mitochondrial stress. The intestinal nuclei appeared smaller and much more condensed in cco-1 RNAi-treated animals, while in contrast, met-2 and lin-65 animals had enlarged nuclei and a loose chromatin structure that remained relatively loose in structure even after mitochondrial stress was induced by cco-1 RNAi (Figure 3A)." | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005792 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0005634 | PATO:0000586 | Paper_evidence | WBPaper00050412 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002078 | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We therefore examined whether animals with reduced ETC function exhibit changes in methylation patterns. To this end, we performed immunohistochemistry against H3K9me2 marks in germlines carrying mutations in met-2 or lin-65. In agreement with previous reports, H3K9me2 level was almost undetectable in met-2 mutants (Figure S3A). Intriguingly, however, we found that lin-65 mutation severely reduced H3K9me2 levels as well (Figure S3A)... met-2 or lin-65 mutations also abolished or severely reduced H3K9me2 methylation in intestinal cells under basal or mitochondrial stress conditions compared to wild-type animals (Figures 3A and 3B)." | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We crossed the lin-65(n3441) mutation into animals harboring a reporter (hsp-4p::gfp) for an ER-specific stress response, the UPRer (Ron and Walter, 2007). Animals were then treated with the ER-specific stressor tunicamycin, which blocks N-linked glycosylation and induces the UPRer (Heifetz et al., 1979). lin-65 did not affect the upregulation of the hsp-4p::gfp reporter by tunicamycin (Figure S1C)." | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Similarly, we observed that lin-65 animals were fully capable of a cytoplasmic response to a heat shock through upregulation of an hsp-16.2p::gfp reporter (Figure S1D) (Link et al., 1999)." | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00050412 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0030968 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO:0009408 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Synchronized day 1 of adulthood animals were placed at 34C for 20 min and allowed to recover for 6 hr prior to imaging." | Paper_evidence | WBPaper00050412 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | zcIs4 [hsp-4p::GFP] | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
dvIs70 [hsp-16.2p::GFP] | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001485 | Paper_evidence | WBPaper00050412 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We crossed the lin-65(n3441) mutation into animals harboring a reporter (hsp-4p::gfp) for an ER-specific stress response, the UPRer (Ron and Walter, 2007). Animals were then treated with the ER-specific stressor tunicamycin, which blocks N-linked glycosylation and induces the UPRer (Heifetz et al., 1979). lin-65 did not affect the upregulation of the hsp-4p::gfp reporter by tunicamycin (Figure S1C)." | Paper_evidence | WBPaper00050412 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00050412 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0030968 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | zcIs4 [hsp-4p::GFP] | Paper_evidence | WBPaper00050412 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00027336 | ||||||||
WBPaper00044613 | |||||||||
WBPaper00050412 | |||||||||
Method | Substitution_allele |