WormBase Tree Display for Variation: WBVar00090774
expand all nodes | collapse all nodes | view schema
WBVar00090774 | Evidence | Paper_evidence | WBPaper00029251 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n3809 | |||||||
Other_name | R06C7.7a.1:c.475C>T | ||||||||
R06C7.7b.1:c.838C>T | |||||||||
CE37542:p.Gln159Ter | |||||||||
CE31573:p.Gln280Ter | |||||||||
HGVSg | CHROMOSOME_I:g.7250118G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R06C7 | |||||
Flanking_sequences | cagaattgcattgatggcgaaatcgtcggc | aaacttcgctgtctccaaaattcgatgaag | |||||||
Mapping_target | R06C7 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00029251 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027399 | ||||||||
WBStrain00027401 | |||||||||
WBStrain00027402 | |||||||||
WBStrain00027403 | |||||||||
WBStrain00027404 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003041 | |||||||
Transcript | R06C7.7b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R06C7.7b.1:c.838C>T | ||||||||
HGVSp | CE31573:p.Gln280Ter | ||||||||
cDNA_position | 838 | ||||||||
CDS_position | 838 | ||||||||
Protein_position | 280 | ||||||||
Exon_number | 5/7 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
R06C7.7a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R06C7.7a.1:c.475C>T | ||||||||
HGVSp | CE37542:p.Gln159Ter | ||||||||
cDNA_position | 475 | ||||||||
CDS_position | 475 | ||||||||
Protein_position | 159 | ||||||||
Exon_number | 4/7 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000504623 | ||||||||
WBInteraction000504629 | |||||||||
WBInteraction000541839 | |||||||||
WBInteraction000558597 | |||||||||
Genetics | Interpolated_map_position | I | 1.85901 | ||||||
Description | Phenotype | WBPhenotype:0000059 | Paper_evidence | WBPaper00038168 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals show weak larval arrest at 26 deg C. | Paper_evidence | WBPaper00038168 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 26 | Paper_evidence | WBPaper00038168 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00053212 | |||||||
Curator_confirmed | WBPerson1984 | ||||||||
Remark | "Furthermore, during vulva development, we observed that ~19% of lag-1(RNAi) animals and ~11% of lin-61(n3809) mutants present a protruding vulva phenotype (Pvl), compared to only ~2% for the control (N2) animals." (Figure 6F) | Paper_evidence | WBPaper00053212 | ||||||
Curator_confirmed | WBPerson1984 | ||||||||
Penetrance | Low | 11% | Paper_evidence | WBPaper00053212 | |||||
Curator_confirmed | WBPerson1984 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00053212 | |||||
Curator_confirmed | WBPerson1984 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00049368 | |||||||
Curator_confirmed | WBPerson632 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00044613 | |||||||
Curator_confirmed | WBPerson24243 | ||||||||
Remark | VC1, VC2, VC3, and VC6 ectopically express the VC4/VC5-specific gene unc-4; uIs45 [unc-4p::MDM2::GFP] was used as the reporter for unc-4. | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004621 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004619 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004618 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004611 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
Phenotype_assay | Genotype | uIs45 [unc-4p::MDM2::GFP] | Paper_evidence | WBPaper00044613 | |||||
Curator_confirmed | WBPerson24243 | ||||||||
WBPhenotype:0001510 | Paper_evidence | WBPaper00044613 | |||||||
Curator_confirmed | WBPerson24243 | ||||||||
Remark | VC1, VC2, VC3, and VC6 ectopically express the VC4/VC5-specific gene unc-4; uIs45 [unc-4p::MDM2::GFP] was used as the reporter for unc-4. | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004621 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004619 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004618 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004611 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
Phenotype_assay | Genotype | uIs45 [unc-4p::MDM2::GFP] | Paper_evidence | WBPaper00044613 | |||||
Curator_confirmed | WBPerson24243 | ||||||||
WBPhenotype:0001938 | Paper_evidence | WBPaper00042141 | |||||||
Curator_confirmed | WBPerson8161 | ||||||||
Remark | lin-61 mutants manifest numerous problems associated with defective HR in germ and somatic cells but remain proficient in meiotic recombination. | Paper_evidence | WBPaper00042141 | ||||||
Curator_confirmed | WBPerson8161 | ||||||||
Reference | WBPaper00038168 | ||||||||
WBPaper00019686 | |||||||||
WBPaper00042141 | |||||||||
WBPaper00044613 | |||||||||
WBPaper00053212 | |||||||||
WBPaper00049368 | |||||||||
Method | Substitution_allele |