WormBase Tree Display for Variation: WBVar00090779

WBVar00090779 Evidence: Paper_evidence: WBPaper00027659
  Name: Public_name: n4039
    Other_name: C02C6.1b.1:c.611G>A
      C02C6.1a.1:c.611G>A
      CE07832:p.Gly204Glu
      CE07833:p.Gly204Glu
    HGVSg: CHROMOSOME_X:g.15569777G>A
  Sequence_details: SMap: S_parent: Sequence: C02C6
    Flanking_sequences: aagtcgatccacagggtcttcgcacgattg agtcctcaccaaacttgacttgatggacga
    Mapping_target: C02C6
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00027659
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: MT
    Status: Live
  Affects: Gene: WBGene00001130
    Transcript: C02C6.1b.1 (12)
      C02C6.1a.1 (12)
    Interactor: WBInteraction000517319
  Genetics: Interpolated_map_position: X 22.8503
  Description: Phenotype: WBPhenotype:0000885 Paper_evidence: WBPaper00038317
        Curator_confirmed: WBPerson712
        Remark: Persistent cell corpses accumulate. Paper_evidence: WBPaper00038317
            Curator_confirmed: WBPerson712
  Reference: WBPaper00038317
    WBPaper00027659
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001130 Missense 204 G to E Paper_evidence: WBPaper00027659
  Method: Substitution_allele