WormBase Tree Display for Variation: WBVar00090832
expand all nodes | collapse all nodes | view schema
WBVar00090832 | Evidence | Paper_evidence | WBPaper00030864 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n4337 | ||||||
Other_name | C43E11.3b.3:c.757_1877+2del | |||||||
C43E11.3a.1:c.799_1919+2del | ||||||||
C43E11.3b.1:c.757_1877+2del | ||||||||
C43E11.3b.2:c.757_1877+2del | ||||||||
HGVSg | CHROMOSOME_I:g.4256308_4258167del | |||||||
Sequence_details | SMap | S_parent | Sequence | C43E11 | ||||
Flanking_sequences | gacacaccacctccaaattttgcgaaaaga | aagttattatttataaatttgacttaaaaa | ||||||
Mapping_target | C43E11 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027452 | |||||||
WBStrain00027568 | ||||||||
WBStrain00056265 | ||||||||
Laboratory | MT | |||||||
ZAS | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00016603 | ||||||
Transcript | C43E11.3b.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C43E11.3b.3:c.757_1877+2del | |||||||
cDNA_position | 766-? | |||||||
CDS_position | 757-? | |||||||
Protein_position | 253-? | |||||||
Intron_number | 5-8/14 | |||||||
Exon_number | 5-8/15 | |||||||
C43E11.3b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C43E11.3b.2:c.757_1877+2del | |||||||
cDNA_position | 963-? | |||||||
CDS_position | 757-? | |||||||
Protein_position | 253-? | |||||||
Intron_number | 6-9/15 | |||||||
Exon_number | 6-9/16 | |||||||
C43E11.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C43E11.3a.1:c.799_1919+2del | |||||||
cDNA_position | 1006-? | |||||||
CDS_position | 799-? | |||||||
Protein_position | 267-? | |||||||
Intron_number | 6-9/15 | |||||||
Exon_number | 6-9/16 | |||||||
C43E11.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C43E11.3b.1:c.757_1877+2del | |||||||
cDNA_position | 977-? | |||||||
CDS_position | 757-? | |||||||
Protein_position | 253-? | |||||||
Intron_number | 6-9/15 | |||||||
Exon_number | 6-9/16 | |||||||
Interactor | WBInteraction000502975 | |||||||
WBInteraction000503731 | ||||||||
WBInteraction000520948 | ||||||||
WBInteraction000565326 | ||||||||
Genetics | Interpolated_map_position | I | -1.53286 | |||||
Description | Phenotype | WBPhenotype:0000111 | Paper_evidence | WBPaper00046612 | ||||
Curator_confirmed | WBPerson25837 | |||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00040969 | ||||||
Curator_confirmed | WBPerson49112 | |||||||
Remark | CeCENP-A. Figure4. "The met-1 mutant is viable and fertile, indicating that transcription is not globally misregulated in this mutant. Consistent with this, the genome-wide distributions of H3K36me3, RNA Pol II and CeCENP-A were similar in met-1 and wild-type embryos (Fig. 4a; genome-wide correlation coefficients of 0.88, 0.9 and 0.9, respectively). However, we observed rare regions of ectopic H3K36me3 enrichment in the met-1 mutant (Fig. 4 and Supplementary Figures 11 and 12). Out of 132 regions > 5 kb in size that acquired ectopic H3K36me3 signal in met-1 mutant embryos, 75 did not show significant RNA Pol II occupancy in embryos, suggesting that these regions are mistranscribed in mutant germlines but not in embryos. CeCENP-A was depleted from these regions in embryos (Fig. 4a, b and Supplementary Figs 11 and 12a)." | Paper_evidence | WBPaper00040969 | |||||
Curator_confirmed | WBPerson49112 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00040969 | |||||
Curator_confirmed | WBPerson49112 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00040969 | ||||
Curator_confirmed | WBPerson49112 | |||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00030864 | ||||||
Curator_confirmed | WBPerson1730 | |||||||
Remark | class B gene, synthetic Muv with class A mutations | Paper_evidence | WBPaper00030864 | |||||
Curator_confirmed | WBPerson1730 | |||||||
Phenotype_assay | Genotype | lin-15A(n767) | Paper_evidence | WBPaper00030864 | ||||
Curator_confirmed | WBPerson1730 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00046612 | ||||||
Curator_confirmed | WBPerson25837 | |||||||
WBPhenotype:0001504 | Paper_evidence | WBPaper00037131 | ||||||
Curator_confirmed | WBPerson13811 | |||||||
WBPhenotype:0002078 | Paper_evidence | WBPaper00040969 | ||||||
Curator_confirmed | WBPerson49112 | |||||||
Remark | Quote from paper: "However, we observed rare regions of ectopic H3K36me3 enrichment in the met-1 mutant (Fig. 4 and Supplementary Figures 11 and 12). Out of 132 regions > 5 kb in size that acquired ectopic H3K36me3 signal in met-1 mutant embryos, 75 did not show significant RNA Pol II occupancy in embryos, suggesting that these regions are mistranscribed in mutant germlines but not in embryos. " | Paper_evidence | WBPaper00040969 | |||||
Curator_confirmed | WBPerson49112 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00040969 | |||||
Curator_confirmed | WBPerson49112 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00040969 | |||||
Curator_confirmed | WBPerson49112 | |||||||
Remark | Quote from paper: "The met-1 mutant is viable and fertile, indicating that transcription is not globally misregulated in this mutant." | Paper_evidence | WBPaper00040969 | |||||
Curator_confirmed | WBPerson49112 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00040969 | |||||
Curator_confirmed | WBPerson49112 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00040969 | ||||||
Curator_confirmed | WBPerson49112 | |||||||
Remark | Quote from paper: "The met-1 mutant is viable and fertile, indicating that transcription is not globally misregulated in this mutant." | Paper_evidence | WBPaper00040969 | |||||
Curator_confirmed | WBPerson49112 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00040969 | |||||
Curator_confirmed | WBPerson49112 | |||||||
Reference | WBPaper00030864 | |||||||
WBPaper00046612 | ||||||||
WBPaper00037131 | ||||||||
WBPaper00040969 | ||||||||
WBPaper00065754 | ||||||||
Method | Deletion_allele |