WormBase Tree Display for Variation: WBVar00090913
expand all nodes | collapse all nodes | view schema
| WBVar00090913 | Evidence | Paper_evidence | WBPaper00030864 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n5021 | |||||||
| Other_name | Y43F4B.3.1:c.1311+81_1905-282del | ||||||||
| HGVSg | CHROMOSOME_III:g.13287437_13289415del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | Y43F4B | |||||
| Flanking_sequences | aaaataacttattttttcgttttccaatat | cagaataaatagaaattcgacaaaagcccc | |||||||
| Mapping_target | Y43F4B | ||||||||
| Type_of_mutation | Deletion | ||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00027579 | ||||||||
| WBStrain00050680 | |||||||||
| WBStrain00050682 | |||||||||
| WBStrain00050691 | |||||||||
| WBStrain00050692 | |||||||||
| WBStrain00051705 | |||||||||
| WBStrain00051707 | |||||||||
| WBStrain00051708 | |||||||||
| WBStrain00054548 | |||||||||
| WBStrain00056264 | |||||||||
| Laboratory | MT | ||||||||
| ZAS | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00012802 | |||||||
| Transcript | Y43F4B.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | Y43F4B.3.1:c.1311+81_1905-282del | ||||||||
| Intron_number | 5-7/9 | ||||||||
| Exon_number | 6-7/10 | ||||||||
| Interactor | WBInteraction000521421 | ||||||||
| WBInteraction000537606 | |||||||||
| WBInteraction000537607 | |||||||||
| WBInteraction000541390 | |||||||||
| Genetics | Interpolated_map_position | III | 21.203 | ||||||
| Description | Phenotype | WBPhenotype:0000679 | Paper_evidence | WBPaper00050412 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Because both H3K9me2 and H3K9me3 are important for heterochromatin formation and gene silencing, we tested whether set-25 has a similar effect on DVE-1 localization on mitochondrial stress. To this end, we monitored nuclear DVE-1::GFP localization in set-25(n5021) mutants in which H3K9me2 levels are elevated (Figure S3A). Remarkably, we observed an opposing phenotype: set-25 mutants increased DVE-1::GFP nuclear localization even in the absence of mitochondrial stress (Figure S5A)." | Paper_evidence | WBPaper00050412 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| GO:0005634 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | zcIs39 [dve-1p::dve-1::gfp] | Paper_evidence | WBPaper00050412 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001236 | Paper_evidence | WBPaper00061351 | |||||||
| Curator_confirmed | WBPerson13958 | ||||||||
| Remark | Fig EV2E | Paper_evidence | WBPaper00061351 | ||||||
| Curator_confirmed | WBPerson13958 | ||||||||
| WBPhenotype:0001504 | Paper_evidence | WBPaper00046104 | |||||||
| Curator_confirmed | WBPerson10085 | ||||||||
| Remark | Maternal-effect sterile at 25 degrees Celsius when combined with met-2(n4256). | Paper_evidence | WBPaper00046104 | ||||||
| Curator_confirmed | WBPerson10085 | ||||||||
| Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00046104 | ||||||
| Curator_confirmed | WBPerson10085 | ||||||||
| WBPhenotype:0001828 | Paper_evidence | WBPaper00050993 | |||||||
| Curator_confirmed | WBPerson31874 | ||||||||
| WBPhenotype:0002078 | Paper_evidence | WBPaper00050412 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "In contrast, consistent with a role for set-25 in H3K9me3, we observed an increase in H3K9me2 marks in set-25 mutants (Figure S3A)." | Paper_evidence | WBPaper00050412 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00050412 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00050412 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "The DVE-1::GFP accumulation in set-25 mutants, however, was neither required for cco-1 RNAi-induced longevity nor sufficient for lifespan extension (Figure S5B; Table S1)." | Paper_evidence | WBPaper00050412 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000743 | Paper_evidence | WBPaper00044603 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Transgene expression is wild-type | Paper_evidence | WBPaper00044603 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | mgIs30 | Paper_evidence | WBPaper00044603 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002168 | Paper_evidence | WBPaper00045092 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00030864 | ||||||||
| WBPaper00044603 | |||||||||
| WBPaper00045092 | |||||||||
| WBPaper00046104 | |||||||||
| WBPaper00050412 | |||||||||
| WBPaper00050993 | |||||||||
| WBPaper00061351 | |||||||||
| WBPaper00064961 | |||||||||
| WBPaper00065293 | |||||||||
| WBPaper00065754 | |||||||||
| Method | Deletion_allele |
