WormBase Tree Display for Variation: WBVar00090970
expand all nodes | collapse all nodes | view schema
WBVar00090970 | Evidence | Paper_evidence | WBPaper00003711 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ne300 | ||||||
Other_name | CE28243:p.Gln825Ter | |||||||
K08H10.7.1:c.2473C>T | ||||||||
HGVSg | CHROMOSOME_V:g.9988709G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | K08H10 | ||||
Flanking_sequences | gagcttcgatctttaaaaagcgaagtaaaa | aattcatgtcggaacgggatggagaagatc | ||||||
Mapping_target | K08H10 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003711 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034049 | |||||||
WBStrain00034050 | ||||||||
WBStrain00034057 | ||||||||
WBStrain00040420 | ||||||||
WBStrain00040438 | ||||||||
WBStrain00050715 | ||||||||
WBStrain00050716 | ||||||||
Laboratory | WM | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004323 | ||||||
Transcript | K08H10.7.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | K08H10.7.1:c.2473C>T | |||||||
HGVSp | CE28243:p.Gln825Ter | |||||||
cDNA_position | 2501 | |||||||
CDS_position | 2473 | |||||||
Protein_position | 825 | |||||||
Exon_number | 11/13 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Genetics | Interpolated_map_position | V | 2.2278 | |||||
Description | Phenotype | WBPhenotype:0000032 | Paper_evidence | WBPaper00044603 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | animals are sick | Paper_evidence | WBPaper00044603 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | mgIs30 | Paper_evidence | WBPaper00044603 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000743 | Paper_evidence | WBPaper00044603 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | sick | Paper_evidence | WBPaper00044603 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | mgIs30 | Paper_evidence | WBPaper00044603 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001208 | Paper_evidence | WBPaper00046393 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | GFP::RDE-8(D76N) failed to capture target mRNA in the rde-1(ne300) mutant background (Figure 6B). | Paper_evidence | WBPaper00046393 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001595 | Paper_evidence | WBPaper00025011 | ||||||
Curator_confirmed | WBPerson3423 | |||||||
Phenotype_not_observed | WBPhenotype:0000033 | Paper_evidence | WBPaper00026761 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | These worms display no obvious let-7-like heterochronic phenotypes. | Paper_evidence | WBPaper00026761 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00026761 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No apparent differences from wild-type in lin-41 mRNA regulation were detected in RNA collected from rde-1(ne300) mutant worms, which are fully RNAi defective. | Paper_evidence | WBPaper00026761 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000743 | Paper_evidence | WBPaper00044603 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Transgene expression is wild-type | Paper_evidence | WBPaper00044603 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | mgIs30 | Paper_evidence | WBPaper00044603 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00026761 | |||||||
WBPaper00003711 | ||||||||
WBPaper00025011 | ||||||||
WBPaper00044603 | ||||||||
WBPaper00046393 | ||||||||
WBPaper00065312 | ||||||||
WBPaper00065315 | ||||||||
WBPaper00066038 | ||||||||
Method | Substitution_allele |