WormBase Tree Display for Variation: WBVar00090996
expand all nodes | collapse all nodes | view schema
WBVar00090996 | Evidence | Paper_evidence | WBPaper00026736 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ne1539 | |||||||
Other_name | F52F12.3.1:c.463T>C | ||||||||
CE24994:p.Ser155Pro | |||||||||
HGVSg | CHROMOSOME_I:g.9899414A>G | ||||||||
Sequence_details | SMap | S_parent | Sequence | F52F12 | |||||
Flanking_sequences | CACATTAATTATACAATTGATCATGTGGCT | CATGGATGTTTCAACTATCATCCGCCGTCG | |||||||
Mapping_target | F52F12 | ||||||||
Type_of_mutation | Substitution | t | c | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00008483 | ||||||||
WBStrain00040428 | |||||||||
Laboratory | WM | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003396 | |||||||
Transcript | F52F12.3.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F52F12.3.1:c.463T>C | ||||||||
HGVSp | CE24994:p.Ser155Pro | ||||||||
cDNA_position | 681 | ||||||||
CDS_position | 463 | ||||||||
Protein_position | 155 | ||||||||
Exon_number | 6/13 | ||||||||
Codon_change | Tca/Cca | ||||||||
Amino_acid_change | S/P | ||||||||
Interactor | WBInteraction000502190 | ||||||||
WBInteraction000503965 | |||||||||
WBInteraction000503968 | |||||||||
WBInteraction000519777 | |||||||||
WBInteraction000524910 | |||||||||
WBInteraction000541768 | |||||||||
WBInteraction000542277 | |||||||||
WBInteraction000542278 | |||||||||
Isolation | Mutagen | ENU | |||||||
Genetics | Interpolated_map_position | I | 3.99721 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00026736 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants have defects in P2/EMS signaling | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00026736 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00026736 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00026736 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00026736 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | WRM-1 levels were absent in the E nucleus. The GFP signal was strongly excluded from the nucleus in all cells in the early embryo. This nuclear exclusion was not dependent on IMB-4 | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0001975 | PATO:0000460 | Paper_evidence | WBPaper00026736 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0001001 | PATO:0000460 | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000071 | PATO:0000460 | Paper_evidence | WBPaper00026736 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000007 | PATO:0000460 | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000008 | PATO:0000460 | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00026736 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | mom-4 mutants carrying the WRM-1::GFP transgene were examined. Nuclear retention was assayed by subjecting the animals to imb-4 RNAi | Paper_evidence | WBPaper00026736 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 25C | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | neIs2 [WRM-1::GFP] | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00026736 | ||||||||
Method | Substitution_allele |