WormBase Tree Display for Variation: WBVar00091271

WBVar00091271 Name: Public_name: nj1
    Other_name: CE47095:p.Asp558Asn
      F57F5.5c.1:c.1672G>A
      CE46445:p.Asp415Asn
      CE29092:p.Asp502Asn
      F57F5.5a.3:c.1504G>A
      F57F5.5a.2:c.1504G>A
      F57F5.5b.1:c.1243G>A
      F57F5.5a.1:c.1504G>A
    HGVSg: CHROMOSOME_V:g.12016664C>T
  Sequence_details: SMap: S_parent: Sequence: F57F5
    Flanking_sequences: taaaaataaaacatccgctaaattttcaga atttgaaacttgataatattcttcttgacg
    Mapping_target: F57F5
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00025220
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00021992
    Laboratory: IK
    Status: Live
  Affects: Gene: WBGene00004032
    Transcript: F57F5.5b.1 (12)
      F57F5.5a.1 (12)
      F57F5.5a.2 (12)
      F57F5.5c.1 (12)
      F57F5.5a.3 (12)
  Genetics: Interpolated_map_position: V 3.58319
  Description: Phenotype: WBPhenotype:0000998 Paper_evidence: WBPaper00028886
          WBPaper00035614
        Curator_confirmed: WBPerson48
          WBPerson2021
        Remark: The thermophilic mutant ttx-4 showed a consistent migration toward warm temperatures, even on a steep gradient (1.2C/cm) and regardless of the conditioning temperature Paper_evidence: WBPaper00035614
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001468 Paper_evidence: WBPaper00032215
        Curator_confirmed: WBPerson712
        Remark: Animals showed weakened attraction to benzaldehyde, similar to gcy-28 mutants, compared to wild-type worms. Paper_evidence: WBPaper00032215
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00002087 Paper_evidence: WBPaper00032215
              Curator_confirmed: WBPerson712
      WBPhenotype:0001469 Paper_evidence: WBPaper00032215
        Curator_confirmed: WBPerson712
        Remark: Animals avoided butanone instead of being attracted to it, a response similar to gcy-28 mutants. Paper_evidence: WBPaper00032215
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00005086 Paper_evidence: WBPaper00032215
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000436 Paper_evidence: WBPaper00028886
        Curator_confirmed: WBPerson48
        Remark: Localization of the synaptic protein SNG-1 is normal, based on expression analysis using an SNG-1::GFP transgene. Paper_evidence: WBPaper00028886
            Curator_confirmed: WBPerson48
      WBPhenotype:0002563 Paper_evidence: WBPaper00032215
        Curator_confirmed: WBPerson712
        Remark: Calcium levels in AWC-ON in response to butanone were normal compared to wild-type animals. Paper_evidence: WBPaper00032215
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005832 PATO:0000460 Paper_evidence: WBPaper00032215
                Curator_confirmed: WBPerson712
  Reference: WBPaper00028886
    WBPaper00032215
    WBPaper00035614
  Remark: This mutation alters a conserved amino acid in the catalytic group. Paper_evidence: WBPaper00025220
  Method: Substitution_allele