WormBase Tree Display for Variation: WBVar00091436
expand all nodes | collapse all nodes | view schema
WBVar00091436 | Name | Public_name | nx77 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | T25F10.5.1:c.309-38_875del | ||||||||
HGVSg | CHROMOSOME_V:g.6763588_6764406del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T25F10 | |||||
Flanking_sequences | ttgagatttttacacgagcatacaaaaata | tgttcaggaagcgctgggagagtacgacga | |||||||
Mapping_target | T25F10 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027641 | ||||||||
WBStrain00049022 | |||||||||
Laboratory | MX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000244 | |||||||
Transcript | T25F10.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T25F10.5.1:c.309-38_875del | ||||||||
cDNA_position | ?-930 | ||||||||
CDS_position | ?-875 | ||||||||
Protein_position | ?-292 | ||||||||
Intron_number | 3-6/10 | ||||||||
Exon_number | 4-7/11 | ||||||||
Interactor | WBInteraction000520984 | ||||||||
WBInteraction000524549 | |||||||||
WBInteraction000524550 | |||||||||
WBInteraction000524551 | |||||||||
Genetics | Interpolated_map_position | V | 0.146809 | ||||||
Mapping_data | In_multi_point | 4923 | |||||||
Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00060242 | |||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show defects in butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002053 | Paper_evidence | WBPaper00055368 | |||||||
Curator_confirmed | WBPerson466 | ||||||||
Remark | survive 10nM ivermectin | Paper_evidence | WBPaper00055368 | ||||||
Curator_confirmed | WBPerson466 | ||||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00055368 | |||||
Curator_confirmed | WBPerson466 | ||||||||
Disease_info | Models_disease | DOID:1935 | |||||||
DOID:0060340 | |||||||||
Models_disease_in_annotation | WBDOannot00000041 | ||||||||
WBDOannot00000414 | |||||||||
WBDOannot00000926 | |||||||||
Reference | WBPaper00029016 | ||||||||
WBPaper00029060 | |||||||||
WBPaper00055368 | |||||||||
WBPaper00060242 | |||||||||
WBPaper00061932 | |||||||||
Remark | This allele contains two deletions. One has flanking sequences of ttgagatttttacacgagcatacaaaaata and caagagctgtgagcagcacatctgcaagaa, the other has flanking sequences of gcctcggaacggtagcatattaaaaccttt and tgttcaggaagcgctgggagagtacgacga. | Paper_evidence | WBPaper00024240 | ||||||
Method | Deletion_allele |