WormBase Tree Display for Variation: WBVar00091556
expand all nodes | collapse all nodes | view schema
WBVar00091556 | Evidence | Paper_evidence | WBPaper00004900 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | C26G2 | |||
Flanking_sequences | atttattctacttatacctgaaagtgccac | attggtgtcacttttgttcgaactcatcaa | |||||
Mapping_target | C26G2 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok255_external | ||||||
ok255_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00005272 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00004854 | |||||
Transcript | F40E10.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | F40E10.4.1:c.48_1019+8del | ||||||
cDNA_position | 95-? | ||||||
CDS_position | 48-? | ||||||
Protein_position | 16-? | ||||||
Intron_number | 2-11/33 | ||||||
Exon_number | 2-11/34 | ||||||
Interactor | WBInteraction000524191 | ||||||
WBInteraction000537329 | |||||||
WBInteraction000537350 | |||||||
WBInteraction000537352 | |||||||
Description | Phenotype | WBPhenotype:0000384 | Paper_evidence | WBPaper00040335 | |||
Curator_confirmed | WBPerson7190 | ||||||
Remark | AVM axon guidance defective | Paper_evidence | WBPaper00040335 | ||||
Curator_confirmed | WBPerson7190 | ||||||
WBPhenotype:0001140 | Paper_evidence | WBPaper00050480 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | slt-1 mutations had no effect on AQR and PQR migration on their own | Paper_evidence | WBPaper00050480 | ||||
Curator_confirmed | WBPerson712 | ||||||
EQ_annotations | Anatomy_term (2) | ||||||
Phenotype_not_observed (3) | |||||||
Reference | WBPaper00040335 | ||||||
WBPaper00032446 | |||||||
WBPaper00032907 | |||||||
WBPaper00045955 | |||||||
WBPaper00050480 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |