WormBase Tree Display for Variation: WBVar00091556
expand all nodes | collapse all nodes | view schema
WBVar00091556 | Evidence | Paper_evidence | WBPaper00004900 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok255 | |||||||
Other_name | F40E10.4.1:c.48_1019+8del | ||||||||
HGVSg | CHROMOSOME_X:g.14674422_14676681del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C26G2 | |||||
Flanking_sequences | atttattctacttatacctgaaagtgccac | attggtgtcacttttgttcgaactcatcaa | |||||||
Mapping_target | C26G2 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok255_external | ||||||||
ok255_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (6) | |||||||||
Affects | Gene | WBGene00004854 | |||||||
Transcript | F40E10.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F40E10.4.1:c.48_1019+8del | ||||||||
cDNA_position | 95-? | ||||||||
CDS_position | 48-? | ||||||||
Protein_position | 16-? | ||||||||
Intron_number | 2-11/33 | ||||||||
Exon_number | 2-11/34 | ||||||||
Interactor | WBInteraction000524191 | ||||||||
WBInteraction000537329 | |||||||||
WBInteraction000537350 | |||||||||
WBInteraction000537352 | |||||||||
Description | Phenotype (2) | ||||||||
Phenotype_not_observed | WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Animals did not have PLM branch defects. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | HSN axons outgrowth does not significantly differ from control animals. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00032907 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (5) | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |