WormBase Tree Display for Variation: WBVar00091557
expand all nodes | collapse all nodes | view schema
WBVar00091557 | Name | Public_name | ok256 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.6315571_6317352del | ||||
Sequence_details | SMap | S_parent | Sequence | F26B1 | |
Flanking_sequences | CAATTCGGAATCGGAGCTCGAGGAGCCAGA | TCCGCGTTTTTGTCTATGTGTTCGTCGCGGG | |||
Mapping_target | F26B1 | ||||
Type_of_mutation | Deletion | ||||
PCR_product | ok256_external | ||||
ok256_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00003849 | ||||
WBStrain00003850 | |||||
WBStrain00003851 | |||||
WBStrain00040617 | |||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00002073 | |||
Transcript | F26B1.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | 245-? | ||||
CDS_position | 231-? | ||||
Protein_position | 77-? | ||||
Intron_number | 3-5/6 | ||||
Exon_number | 3-7/7 | ||||
Genetics | Mapping_data | In_multi_point | 4438 | ||
Remark | Knockout allele sequenced by the Vancouver Gene Knockout Lab (part of the C. elegans Gene Knockout Consortium) | ||||
Last updated on 29 Nov 2002 | |||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |