WormBase Tree Display for Variation: WBVar00091602
expand all nodes | collapse all nodes | view schema
| WBVar00091602 | Evidence | Paper_evidence | WBPaper00032117 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ok304 | |||||
| Other_name | T07D3.7b.1:c.102_1119del | ||||||
| CE13367:p.Thr35IlefsTer9 | |||||||
| CE32063:p.Thr54IlefsTer9 | |||||||
| T07D3.7a.1:c.159_1176del | |||||||
| HGVSg | CHROMOSOME_II:g.874860_876237del | ||||||
| Sequence_details | SMap | S_parent | Sequence | T07D3 | |||
| Flanking_sequences | TTCCTGAATCTCTAATTTTCCAATTTTCAG | GATATTGTTCCAGGACAGCGTTGTCTGAAG | |||||
| Mapping_target | T07D3 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | OK304_external | ||||||
| OK304_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00029031 | ||||||
| WBStrain00031362 | |||||||
| WBStrain00040422 | |||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000106 | |||||
| WBGene00195437 | |||||||
| WBGene00198294 | |||||||
| Transcript | T07D3.7b.1 (11) | ||||||
| T07D3.10 | VEP_consequence | transcript_ablation | |||||
| VEP_impact | HIGH | ||||||
| Exon_number | 1/1 | ||||||
| T07D3.7a.1 (11) | |||||||
| T07D3.11 | VEP_consequence | transcript_ablation | |||||
| VEP_impact | HIGH | ||||||
| Exon_number | 1/1 | ||||||
| Interactor (12) | |||||||
| Genetics | Mapping_data | In_multi_point | 4154 | ||||
| Description | Phenotype (11) | ||||||
| Phenotype_not_observed | WBPhenotype:0000038 | Paper_evidence | WBPaper00040911 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | no bursting through the vulva phenotype (alg-2 0%, n = 40) | Paper_evidence | WBPaper00040911 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000280 | Paper_evidence | WBPaper00040911 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | no gapped alae (alg-2 0%, n = 60) | Paper_evidence | WBPaper00040911 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000867 | Paper_evidence | WBPaper00040911 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Mutants do not have detectable embryonic lethality under standard growth conditions. | Paper_evidence | WBPaper00040911 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00040868 | ||||||
| WBPaper00040911 | |||||||
| WBPaper00027057 | |||||||
| WBPaper00032117 | |||||||
| WBPaper00029211 | |||||||
| WBPaper00061892 | |||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
